Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30277  (registered. 2012)
Contig Information
Length 811 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|33115140|gb|AAP95024.1|| iron/ascorbate-dependent oxidoreductase [Hordeum vulgare]
Score 372
Evalue 2.00E-101
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30277
CCCCACTCACACAAGAGAAACCATCTCTTTATTTATTCTCCACAGGTAATAAATCACTGCTACAAATCCGTAGATAAACTAATTGAGACCGCCGAGCTTG
TATTTTCAGGGTCTCCATGAATCTCTTCCCTTGGCTGAAATGTTATGTTCAGTCGAAAGAAAGACCGAAATCCTTGGCCTTGAATTTCCCATATCTTGCC
GGTCGCTCGTCATCCAGCAAACCAGGCGCTGGCTCCAGCACCGTCTCTCCATCCACAGCATAAAACACGGCCAGTGAAAGCCTCTCTCTCTCGGCGTTCG
TCACCACCCTGTGGACCGGGCTCCTGAAGATCCCGTTGCACATTATCTCCATGCAGTCAGCCAAGTTGATCACCAACGAGTAAGGCTTGGCCGGAACATT
GTACCATCTCCCATCTCTCTCAACTTGCAAGCCACCGACGTCGTGGTCGACAAAAAGGATGGTAAGGAGACCAGCATCAGAGTGAGGCCTCATGCCCAGT
ACTAGGTCAGGTCTCGGACACGGAGGGTAGTAGTTGAACCTAGCAAACCCGGGATCCTTGCTTGATATTTGGTTGAGGAAGTAATCCTCATCAAGGTCCA
GGAGCTTGGCGATCGATCGAAAGACGAGGTCTCTTATTCTCTTGGTTCTTGATGCGTACTCAAGAAGCACATCCCTGAAAGATTTCGGGTGAGCGGGCCA
CTTGGTGAAATTCCTCTCATCTTCTGGCTCCACCCTCAGATGCAGCCGGTCGTTCCAGCTGANNCCCTCGGCCTGGTTTACCACCTCGTCATTTCCATAG
CCTTCCACCTC
page-top