Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3015  (registered. 2012)
Contig Information
Length 1364 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093450|ref|XP_002437215.1|| hypothetical protein SORBIDRAFT_10g023020 [Sorghum bicolor]
Score 137
Evalue 9.00E-50
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3015
GATCGCAATTTTGTTGATCACATTACATCTATGCTCTATTTGTTTGTTTGTTNNNTCCATGCTTCCGCTTTGAGGTTGAACAACAGGTTAAGGAAGCACT
CCTCAATTTTTTTGGGGTTCAACGGAACAGCAGGAGTGTGGAGAATTAAGGCACTCGAGGTCTCTGGAATATGGATGGAGAGAAGGGACTGAACAGGCTG
GGGCTGGGACTTCACCTGCAGGTTCAACTACCTGAGGAAGGGTAGATCGATTGTGGCAAGACAGCCATGCTGCTAGACAAAGGAAGTTAACGAGAGCTGG
GAGAGGATCCTGCTCTGTCCCCAGCTCATCAAGGACATGGACACATGGTACACATGATGGTTAATTCCGCTCTTTGCGTATTCAGGTTTACATCCAGGCT
ATTGGGGAGCAACTCATGGAGATGATGATAATCAAGGGAGCCATCTATGTGACTTCCAACCACGGGGACAACTAGAAGGTAGCCATGCATGAGACCTATC
TCGGCCACTCTGAACAGAGAGGGATGGATTCAATTAAAGTCTGGAAGGAACCAGTCATGCCTTCTTACTCACAAAAAAGGAAAGAAATGGTTTGTGGCTG
GGACATCTGATGGTGTGATCCATGTGTACAATTACGACAACAGAATACAAAAACTCAGAAGTTTCAGAGCCGCCAGTGATTGCTTCATCACATCAATGGC
CGTCAATCCAACCCGTTCGTATGTACTGTCATCGGCTTATCATGATATAAAGCTCTGGGACTGGAGCAAGGGCTGGGAGTGCACAAAATCATTCGTCCAA
GAACACACCGATACTGTAAGTCAGGTCGCATTCAACCCAATGGACACCAACATTTTGTGCTTCAGATGATCACACAGTAAAGGTTTGGAGCATTGGTTCT
CCCGAATCAAAATATACTTTGTATGGGCATCTGGACAAAGTGAACTGCCTTGATTTCTTCAAATGTAATGATCGACAGTATTTGATTACTGGCTCTGATG
ATCACACTGCTAAGATATGGGACATGGAAGAAAAGGCTTGTGTTCATACAATGGAAGCTTTCGTGTCTCCAGTAACTTCTGTCATTGCCCTCGCCGATAG
CCCATACCTAATTACAGGTTCAAAAGATGGCTCCGTTCATTTCTGGAGCTCCGGTGAATTCAGTGATTTCTGCATGGTTCCTAGGCTGGAGAGAATCGTT
AACTTTGGCTCTGGTGGAGCTATTTGGGGTCTCGGACGTTTCATGGGGTCAAGAAGGATTGTGATCGGACAAGAGTACACAGTGTCAATCATGGCCATCG
ACAATGAAGACCAAAACGCTGTCATGTTCGAGACAAAACATATTTCTCTGATGAGATAGTAGAT
page-top