Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig30086  (registered. 2012)
Contig Information
Length 1814 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_VWD Shoot grown with dessication 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|284519770|gb|ADB92637.1|| putative histone acetyltransferase ELP3 [Hordeum vulgare]
Score 1147
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig30086
ACCCTTCCCGATGGCCGCCGCCGTAGCCGCAGCCGCGGCCGACCAGCCGCGCCGCCGGAAGCCGACGCCGGGGCGCGGGGGCGTGGTGCTGCCCGCGGGG
CTCTCCGAGGAGGAGGCGAGGGTGCGGGCCATCGCGGAGATCGTGTCGGAGATGGGCGAGCTCTCGCGCCGCGGGGAGGACGTGGACCTCAACGCGCTCA
AGTCGGCCGCGTGCCGCCGCTACGGGCTCGCCCGCGCGCCCAAGCTGGTGGAGATGATCGCCGCCGTGCCGGAGGCGGACCGCGCGGCGCTGCTGCCCCG
CCTGCGCGCCAAGCCCGTGCGCACGGCGTCGGGCATCGCGGTGGTCGCCGTGATGTCCAAGCCGCACCGGTGCCCCCACATCGCCACCACGGGGAACATC
TGCGTCTACTGCCCGGGAGGCCCCGACTCCGACTTCGAGTACAGCACCCAGTCCTACACTGGATACGAGCCCACCAGCATGCGCGCCATCCGGGCAAGGT
ACAATCCATATGTGCAAGCCAGAAGCAGGATAGATCAGCTCAAAAGGCTCGGACATAGTGCGGATAAGGTCGAGTTCATTTTGATGGGTGGGACTTTCAT
GTCGTTACCGGCTGATTATCGTGATTATTTCATCAGAAATCTCCATGATGCTTTATCGGGACATACTTCTGCTAATGTTGAGGAGGCGGTTTGTTATTCA
GAACATAGTGCTGTCAAATGTATCGGTATGACAATTGAGACGAGACCTGATTATTGCCTGGGGCCTCATCTGCGGCAAATGCTATCTTATGGATGTACCC
GCTTAGAAATTGGTGTGCAGAGTACATATGAGGATGTTGCACGTGACACAAACAGAGGCCATACAGTAGCTGCTGTTGCTGATTGTTTTTCTTTAGCAAA
AGATGCTGGTTTTAAGGTGGTTGCGCACATGATGCCAGATTTACCTAATGTTGGAGTTGAGAGGGATATGGAAAGTTTCAGAGAATTTTTTGAAAATCCA
GCATTCCGAGCAGATGGTCTAAAGATCTATCCAACTCTTGTGATTCGTGGAACTGGTCTTTATGAGCTATGGAAAACTGGAAGGTATAGAAACTACCCAC
CAGAGCTGCTAGTGGATATTGTAGCAAGGATTCTGTCGATGGTACCACCATGGACACGAGTCTATCGGGTCCAGAGAGATATCCCTATGCCTCTTGTTAC
TTCTGGTGTTGAGAAAGGTAACCTGCGTGAGCTTGCTTTGGCTCGAATGGAAGACCTGGGCTTGAAATGCAGAGATGTCAGAACCCGTGAGGCTGGAATT
CAGGATATCCATCACAAGATCAGGCCTGATGAAGTTGAGCTTGTCAGGCGTGATTACGCTGCAAATGACGGTTGGGAGACCTTTCTCTCGTATGAGGATA
CACGACAGGATATCCTTATTGGCCTGTTGCGCTTGCGTAAATGTGGCCGCAATGTTACAGGCCCTGAACTCGTAGGGAGGTGTTCAATTGTCCGTGAACT
TCATGTCTACGGAACAGCGGTCCCTGTGCATGGTCGTGATGCAGAGAAACTGCAACACCAGGGGTATGGGACGCTCCTGATGGAAGAAGCAGAGAGAATT
GCTCGTAAGGAGCATCGATCAAAGAAACTGGCCGTCATCTCAGGAGTTGGAACCCGCCACTACTACCGCAAGCTGGGCTATGAACTTGAGGGGCCTTACA
TGGTCAAATGTCTGGCATAGTGTATTTCAGCATCAAATGGCAATTGTATTGCAACTAGAAAAATCAAATGTGATCATGATGTTAAGTGTAATGTATTTGT
AACCTTAGTTGTTA
page-top