Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3004  (registered. 2012)
Contig Information
Length 774 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|225427403|ref|XP_002263777.1|| PREDICTED: hypothetical protein [Vitis vinifera]
Score 237
Evalue 1.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3004
GGTACCAAGTTTAAGCCCCAGGAAAAAAATCTATAATTGATGAGTTCTTCTTTTCCAATTCCCCACAGGTGCGTCAGGCCATTCATCTGGTCCACCATAG
TATTCCAAGATAGGACAAGCTGACCTGGCATGAGTGTTGCGCCTACTGGAGATACATGCGTTCCCCAATCAACTATTCCCTATCCACCTAAATTTTATGT
CCTCCACAACAAGACCATGATGAATCTCTAGAGCATATACATTTGGGAAAGAACTCTTGCAGACTTTTGCTTCCCTCGGATGATTACTGAAAGCTTCATT
TTTCCCCGTTTTCTTTAGGATATTTATTTTTTCCCTTTTCTCTGAGAGGTAACTCCAGGAAGTTTTCAGGCAGAAGGAAGTATGTTGAGGGCCACTTCTT
TCAGTGATGGCATCTCCTCTTGTTCATGTAAACAGACAAAGCTGCCACCTACTTTTCTCAGCACCTTCCAAGGGCCAGGGTAACACCTGAAAAGTGCTCC
CCCTTTGGATCCTTTAAAATTGTGAATATAGTAAATGGTCTCCAGTTTCGGAAGAAAGGTCTTGGAAAGTTCACCCAACTTTGGATAGAAAAAGGGCGGG
TAATATCCACTTCTTATCCGATCTAGTTCTCCATTGAAGATAATCATTTTCCGTTCTGTATTAAGAACTGCTTCCTTGTAAAGCTCTTCCACCACAAGCA
TTTCATTGACATTGAAATNNNNATAGGCCACAAGGAATATCTCGTCTTCAGGCCGCACACGGTCTGCCATTTTG
page-top