Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3002  (registered. 2012)
Contig Information
Length 1146 bp
Clones alternative view 52 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 9
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|78099745|gb|ABB20895.1|| flavanone 3-hydroxylase [Triticum aestivum]
Score 578
Evalue 4.00E-163
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3002
TTTTTTTTTTGGTGAGCTCAGCTCCTGGACAGCAAATTTATTACATAGTGTTTTCTCTTGCACTGGTGTACCATATGTCGTTACAAGTAGGATCACAATT
AATAAACAAGCGCGTGCGCGCGCGCGCGCGCACACACTAGTATATAGGGAGTACAATACAAGATGAACATCGATAAATACGTTGTGCTCAAGCAAAAACA
AGTTCAAACAACTCGAGTAACCCCGCACATTGGGGGCATTTATTATTTGAGTAATGCTGCGTCGTGGATGAGGCAAGCTTGTGCACACGGATCACTTCTG
ACCCGTGAAGAGCTCCAGGCAATGGTCCTGGTCCAGGTTCCTGCTCCAGAACTTCTTGTAGTACTCGTCGTAGGTGTAGCTGCGGTACACGGGCTCGTCC
CCGTCGCCGACGAGCTTGGCCACCGGGCCGATCACCGCGCTGTTGCACGGGCACAGGAAAGATGCCACCGACAGGCGCTCCCGCGCCGCATTGACCACCG
CGCGGTGCCAGACGCTCTTGTACGCGCCGTTGCTCAGCGCCTGCAACTGGTCGCCTAGGTTGACGACGAGGGCGTTGGGCCGGGGGTCAACGGCGATCCA
CTGGGCGCCGTCCTTGAGGACCTGCAGGCCGGAGACGTGGGGGTCCATGAGGAGAATGGTGAGGGCGTTGGGGTCCGTGTGCTTGGGCAGGCCGTAGGTG
AGGTCCGGCTTAGGGCACCGCGGGTAGTAGTTCACGGCCATGTGCTGCTCCTGCTCGCCCAGCACATTCTCGATGTAGTCCTCCTCGAGGCCCAGGCCCA
GGGAGATCGCGCCCAGGAGTCGGAGGCCGAGCAGCCGAACTTCGCAGCAGTAGGTGCTGATGATCTCCTTGAACGTTTCAGGATTGGACGGCCAGTCGGG
CACGAACTCCTCCAACGGGTGGCAATGAAGGCGCAGATAGTCCCGCCAGTTGTGCACTGTCTCCTTGCGGACGTTGAAGCTTGTAGAAAGCCTTATCTTT
TTGGATGGCTCATCAGAATAGAGCTTGGCCTTCTCTTCCGGCGGGAGCCGGAAAAACTCAAGCCCCACAGCCATCACCTTCTCCAGCAGCTCCTCTGATA
TCCCATGGTTTATGATCTGGAAGAAGCCGTAGGTGCGGCAAGCCTG
page-top