Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29941  (registered. 2012)
Contig Information
Length 1524 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218185380|gb|EEC67807.1|| hypothetical protein OsI_35373 [Oryza sativa Indica Group]
Score 682
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29941
TCGAGCGATCCGTCCGTCTGCCGCCACCTTCATCCCCTCACCCCATGGCGGCCGCCGGGTGGTCCTCGGCCGCCTTCCTCGCACTCCTCCTCCTCCTGCT
CCCGTTCGCGCCCAGCCCAGCACGCGCGGCGACGCCGGGGAAGTCCCCGTCGCCCACGTCCACCGCCGTGTTCCAGCTCCAGGGCGCCGTCTATCCCATC
GGGCATTACTATGTCACCATGAACATTGGGGACCCGGCGAAGCCCTACTTCCTGGACGTCGACACCGGCAGCGACCTCAGCTGGCTGCAGTGCGACGCCC
CCTGCCAAAGCTGCAACAAGGTGCCACACCCATGGTACAAGCCAACAAAGAACAAGATTGTTCCCTGTGCAGCTTCGCTCTGCACTAGTTTGAGCCCTAA
CAAGAAATGCGCCGTACCACAGCAATGTGATTACCAGATCAAGTACACGGACAAGGCAACTTCACTCGGCGTGCTCGTCGCTGACAACTTTACACTGTCC
CTGAGGAATTCATCCACTGTCCGTGCCAACCTCACCTTTGGCTGTGGATATGATCAGCAAGTGGGAAAGAATGGCGCAGTGCAGGCGGCGACGGACGGCT
TGCTTGCGCTTGGGAAAGGATCAGTTAGCCTGCTCTCGCAGCTCAAGCAGCAAGGGATTACCAAGAATGTTGTTGGCCATTGCTTCAGCACGAATGGAGG
AGGCTTCCTGTTCTTCGGGGATGATATCGTACCCACCTCGCGTGTAACTTGGGTTCCCATGGCTCGTACCACATCTGGGAATTACTACTCACCTGGCTCA
GGAACACTGTACTTCGACCGACGCTCGCTAGGGGTGAAGCCAATGGAGGTGGTATTTGACAGCGGTAGTACCTACACCTACTTTGCCGCCCAGCCATACC
AAGCAACTGTGTCTGCGCTCAAAGCTGGTCTCAGCAAGTCACTTAAAGAAGTCTCAGACGTCAGTCTGCCTCTTTGCTGGAAAGGGCAGAAGGTATTCAA
ATCTGTGTCAGAGGTCAAGAACGATTTCAAGTCACTGTTCTTGAACTTTGGCAAGAATTCTGTCATGGAGATCCCTCCGGAAAACTACCTCATTGTCACT
AAATATGGGAATGTGTGCTTAGGCATCCTTGATGGTACGGCTGCTAAACAGACATTCAACATAATTGGAGACATCACAATGCAGGATCAGATGATAATTT
ATGACAATGAGAAAGGGCAGCTTGGATGGATCCGTGGGTCATGCAGTAGAAGCTCTAAGTCTATTATGTCTAACTTTCCATGATCATTTATCAGATCTAA
ATCATTAACCTATCCGTTCGAACACTGGCTGCACCTCAAGCACTATAGGGTGCCATCCAAATAAAAGTACTGTATGTTGTACGTAGTGTATTAACATGAG
CCTGAGGAAAATGAGGCAGAAAGGAGAGGAGAAGAGCCATGCAGATGTAGGCAGATAAAGTTACTGATATGTATGCTCCTCCTGTTCATAATGAAATGGA
GTCTATATTTTACCAAAAAAAAAA
page-top