Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29932  (registered. 2012)
Contig Information
Length 1256 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125555254|gb|EAZ00860.1|| hypothetical protein OsI_22888 [Oryza sativa Indica Group]
Score 692
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29932
TGCAGCCCTACTCCGGTTCCCCCGCCAACTTCGCCGCCTACACTGGGCTGCTCCAACCCCACGAGCGCATCATGGGGCTCGATCTGCCGTCCGGAGGACA
CCTCACTCATGGGTACTACACGGCCGGGGGCAAGAAGATTTCTGCCACCTCCATTTACTTTTCGAGCTTGCCCTACAAGGTGAGCTCCGACACCGGGTAC
GTCGACTATGATAGGCTGGAGGAGAAGGCCATGGATTTCCGCCCCAAGCTCATTATCTGTGGCGGGAGCGCGTACCCACGGGACTGGGATTATGCCAGGC
TTAGGGCCATCGCGGACAAGTGCGGGGCCATGTTGCTGTGTGACATGGCTCATATTAGCGGTCTCGTTGCCGCTCAGGAGGCTACGAATCCGTTTGAGTA
TTCTGATGTGGTTACCACCACCACCCACAAGAGTCTCCGAGGGCCAAGGTCTGGTATGATATTCTACAGGAAGGGCCCGAAGCCTCCCAAAAAAGGCCAG
CCCGAGGGTGCTCTTTACGATTACGAGGACAAAATCAACTTTGCAGTGTTTCCATCACTCCAGGGTGGCCCTCACAACCACCAGATTGCTGCCCTGGCAG
TTGGCCTGAAGCAGGCAATGTCACCTGGATTCAAGGCATATATTCAGCAGGTCAAGGCCAATGCTGTTGCCCTTGGAAACCATCTGATGAGTAAGGGCTA
CAAGATGGTTACTGATGGAACAGAGAACCACCTTGTTCTCTGGGATCTTCGCCCTCTTGGCTTGTCTGGTAACAAAGTTGAGAAAGTATGTGATCTGAGC
AGCATTACACTCAATAAAAATGCCGTCTTTGGCGACAGCAGTGCACTGGCACCTGGTGGTGTGCGAATTGGTACACCTGCCATGACCTCGAGAGGTTTGG
TCGAGAAGGACTTTGTGAAGATTGCTGAGTACCTTCATCAGGCTGTGGTCATCTGCTTGAATGTCCAGAAGCAGCGAGGTAAGCGTTACAATGATTTCAT
CGTTGACTTGGAGAAGAACAAGGACATCGCGGAGCTCAGGGCAGAGGTCGAGAAGTTTGCCATTGCATTTGAGATGCCTGGATTCCTGGTGTCAGACATG
AAATACAAGGATTAGGCTGTGGTACCATGCAGATCGTTTTCTTGTAGCAGCAAATTGGTGCCCTTAAGGGGCTGATTGCTGTGCGCTAATCGTGATGTAT
GAATTATGGTTGAAAATGATATGACTCATGAATAATCATTGAAGGTAAAAAAAAAA
page-top