Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29921  (registered. 2012)
Contig Information
Length 1181 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_VABA Shoot with ABA treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XV Leaves, plant was grown at constant 23Ž 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119371436|dbj|BAF41978.1|| aquaporin [Hordeum vulgare]
Score 578
Evalue 3.00E-163
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29921
CAGGCGAGCAGCGACCACCTTCCGGCGAGGGCAGCAGCGATGGAGGGCAAGGAGGAGGACGTGCGGCTCGGGGCGAACAAGTACTCGGAGCGGCAGCCCA
TCGGCACGGCGGCGCAGGGGTCCGAGGACAAGGACTACAAGGAGCCCCCGCCGGCGCCGCTGTTCGAGCCCGGCGAGCTCAAGTCCTGGTCCTTCTACCG
CGCCGGCATCGCCGAGTTCATGGCCACCTTCCTCTTCCTCTACGTCACCATCCTCACCGTGATGGGCTACAGCGGCGCCACCTCCAAGTGCGCCAGCGTC
GGCATCCAGGGCATCGCCTGGTCCTTCGGCGGCATGATCTTCGCCCTCGTCTACTGCACCGCCGGCATCTCCGGCGGGCACATCAACCCGGCGGTGACCT
TCGGGCTGTTCCTGGCGAGGAAGCTGTCGCTGACCCGGGCGGTGTTCTACATCATCATGCAGTGCCTGGGCGCCATCTGCGGCGCCGGCGTGGTGAAGGG
GTTCCAGCAGGGCCTGTACATGGGCAACGGCGGCGGCGCCAACGTGGTGGCGCCCGGCTACACCAAGGGCTCCGGCCTCGGCGCCGAGATCATCGGCACC
TTCGTCCTCGTCTACACCGTCTTCTCCGCCACCGACGCCAAGAGGAACGCCAGGGACTCCCACGTTCCCATCCTCGCCCCGCTGCCCATCGGGTTCGCCG
TGTTCCTGGTGCACCTGGCCACCATCCCCATCACCGGCACCGGCATCAACCCGGCGAGGAGCCTCGGCGCGGCCATCATCTACAACAGGGAGCACGCCTG
GTCAGACCACTGGATCTTCTGGGTCGGCCCCTTCATCGGCGCCGCGCTGGCTGCCGTCTACCACCAGGTGGTCATCAGAGCGATCCCGTTCAAGACCAAG
TCCTAAGCAGCTGTTCTTCCTGCTACAAAGAAGATGCCAACCCAACCCGAAGAGCAAGCTGCGTGTTCTGAATTTCTGATGGGGCGGCTATATATCTCTT
CCCGTCATCCGTGTTACTGTGGAATTCCAATTTGTCTTCCAAGTTTGATGTACTCTGTATTCACCTGAACCTGGACCCAGACTTGTATGTAATCTCATCA
GTACTCAGTTGTGTGTGCTGCCCGTTATTGTCAAATCGAGCCAAGTTGTTTAAAAAAAAAATTGTTAGAGCTCAGCTCAGC
page-top