Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29687  (registered. 2012)
Contig Information
Length 763 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194705250|gb|ACF86709.1|| unknown [Zea mays]
Score 335
Evalue 4.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29687
ATAACGTACAGTACAGGGTTACAGATGCATGATTCTGAACATCTCTTCAGGAAATCAACAGATTTTGTGCAGGCCGACAGTGCAGTCATAAACATAGGTG
TTAAGTGATAGTATGTCACAGTATACTAACTGATAAATGTAAACTGAATGAATCATATGAACAAATGGAGAGATCAAACGGACAGCTGGAGTATATGATA
CTGCGAAGATATCTTCATCTTCATTTTACCATCGCGTACCTAAGAGTACCGATATTTATTGCATTGCAAGTTCAGATCCGGTTGCCACCATTGGCTAATG
CCATGGGCATATTTGAAGTCCGGTGAAGGGCTCACGTTTACAATCAAGTCTGCAGATGGAAGAAGGTGCAGCGGTTCTGATTCCCATCCTAATGCCTTGT
AAAACAGGTCTCCGATTGAGTTTTGGGTCGCAAGCTTCTCAATAAATCCAGCACCGAGATCCTCCATGTTCCTACGATGCTGGAAGTACCCAATGTACTC
TGAACATACATGGTCTCCTGGATTAACAAACAGATATGGCGTCCATGATGACAAAATGTTGAATGATTCTTCCGCAACAGACCTCTGATTGTTCCCCTCG
GTTTTTGCTTTCATTGCAATAGCTAGTCCCGCGGTAATAACACTTCTTGCAATGCGGAAACCATGCTTTACCCTCTCATCCCTGATTCCCTCTATCGGAG
CAGCGACAAACGGTGGATTGAAGAGAAAACTATCCAAAAAAGCGCCCTTCTTAACCATGTTTC
page-top