Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29617  (registered. 2012)
Contig Information
Length 608 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473665|ref|NP_001060431.1|| Os07g0641700 [Oryza sativa (japonica cultivar-group)]
Score 167
Evalue 7.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29617
GAGTGTGGAAGCGTCGCGTTTTCTTGCTTGTTTCCCAAGAAGAAGGAGAAGAGCGGCGTCTGATCTCGTCGGCGGCGATGGCGGCGATTCGGCGTCTGAT
CCCGTCCTTCAACCGGGTGCTGGTGGAGAAGGTGGTGCAGCCCAAGAAGAGCGCCGGCGGCATCCTCCTCCCGGAGACCTCCAAGCAGCTGAACTCTGGT
AAGGTGATAGCTGTTGGCCCTGGCAGCCGTGACAAGGAAGGGAAGCTGATCCCTGTTGCTCTCAAGGAAGGCGACCATGTGCTCCTGCCTGAGTATGGCG
GTCTTGAAGTCAAGCTTGCTCCTGAGAAAGAGTACCTCCTCTACAGAGACGACGACATTCTGGGCACCCTCCACGAGTGATTCAGATGGTGCGGAAGTCA
TCAGCTGCTTTAATGCAGTAGGAGAGGATGTTAAGAGTTTCCATGTTATCGGATAAATCTTAAAGTAGAACTGTCTTCTATGGTGTGATGATAGATTTTT
ACCTCGAACATCATGAACTTGATATGATTGTTGCCAGACTTTCTGTCGTGATTCAATTCAGTAAACTTGCAGCTGAAGTGCTGCCCTTGATTTTCGTCAA
AAAAAAAA
page-top