Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29604  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242058311|ref|XP_002458301.1|| hypothetical protein SORBIDRAFT_03g030840 [Sorghum bicolor]
Score 298
Evalue 4.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29604
TTTTTTTTTTGAACGTACAACAAATTCTCAAACACTTGATAAAAACAAACCAGGAAAGGCCAAGAAGTTGAGGTAGAGCAAGAAAAGGCACACATGACTT
CAGGATGTTTATTACGGTACAACACTCAAACAAAATATACGTGCACATGGGTCCGTCGCATCCCAACTAGGGTAATAATATACATCACACTCAGTACACG
CGATGCAAGGAGGAAACTTCACATTTCACTAGTTCATCAGTTGGACCTCCATTTTAAACCACTTGATAGTCGATTTCACCTCACCTTGCCAAGACTACTG
AGCAATCAGTCATAGCATGCAGAGCTCATGCATCATTAGCGTAGACACGGGTCCACTCTTTGGCTGTTTCCACAGCTTCTGTTTCGTTGGCCTTCCAGTG
CTTTGCCACATTGTCAGCAAGCGGATCGTCAGGATTTGGAGCGCTGAGGAGTGCTTGAATGCTCAAAAGAACTGTTCGGATCTGAAGGGCAGGACTCCAC
TTGTCCTTTAAGATATCAAGGCATATCCTCCCAAGCTTGTCAATGTTTGGATGGTAAATTTTTGTGAGAAAGCGAACCTTTGGCGGAGCCATTGGATATT
CTTCAGGTAAAAACAACTCAAGTTTGAATACTCCTCCTTCATATGGCGACTGAGTTGGGCCAAGGATCATGACATTGAAGTAGCGCATGTTCTCCTCTGA
TGGTGAAGCACTGATCCCAGGAGCTGGTTCGCTGAGCAGCCGCTGCGTCTCCTTGATGATGCGGCGGGGGAGGTTGCTGTTGGCCATGGAGAAGATGGGT
TGGGCTAGGGCTAGGGTTTCGTGCTCTTGGGATCGATCGCGGCGGAGGGGAGGGGACGGGAGGAGAGGAAGGACCAAAGGAGGCGG
page-top