Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29490  (registered. 2012)
Contig Information
Length 1337 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_EM Dormant seed with water absorption 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|293332496|ref|NP_001169442.1|| hypothetical protein LOC100383313 [Zea mays]
Score 602
Evalue 4.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29490
AGCAGTCTCCAAGCCATAACAACAACAGCTAAGCCCTTTCAATTCATATTCTTTTCTTCCTATCCTCATCTGTACATCCGTCTACACAGCAGCTTAATAC
AACACCATCATCAATCCACGTGGCACGGGGGGGAGGGAGGGTTACAAGCAAGCACTAGTAGCTACTACAGTAGTAGTCATAAGCATCAAGCAACAACCTT
CTTTTTATCTTCTTACCTCTTACACAAAGACTGTCGGCTTCTCTTCCGTTTCGGTCGGTCGCAAGCCATCGTTCTCCTCCAGCCACCTCAAACAGTAGTC
GTCCACGCACACAGACACCAGCGAGAGATTGGCGGTGGCTTAGCCATCAGTCATCTCCTAGGTTTGAATTGATGCAACAATAATAATGCTTGTTTTCCGT
CTCAGGCTTTCGGGATCGACCGGGAAGAAACTCCGTGCAAGAGCTTTATGAACCCGAGGAAGCTCAGCTTCCCGTCGGCGTGCCTGATCCAGTCCTGGAG
GACGACGTGGAGGGGCACCGACGGGCCGAGGCCGAGTTCCGAAGCAAGTTCTTCGATCACGATAGGCCGGTTGCCCTCCTTGTCGAACAGCTCGTACGCG
CGCCGAGCGTGCTGTTCCCAGGTCTCCAGAGCTTCCATCTGATATACGCTGATGGCGGAAGCCGCAAACTCTTCGAAATCCAATTTTCTGTACTGAAGGG
TGCATACCGTGTTAACAAAGTCAATAACCCTGGAATCCTTCATTGCATCCGTAGAATTCTTCACCAGAGCCGATTTCAAATTTTGCAAGGAGATAAAACC
ACTCTTGTTTGGACCCAACAATTCAAACTGCTCTTTTAGATAAAAGAGTTGATTTGCTGTCAATGTCTTAGCTAGGGCCCTCAAAGCAGACTTCCGCAAT
GAAGATGAACTGATATAAGCTCGGATAAGCTTGTAGATTATCATATCTAAAGGAATTTTGACTTGTTGTGCATCACGGATCCATGGGTGACTGAGAGCTT
GTGAGGCAGTCATCCTCTTGCGGTAATCCTTATTAAGCAACCTTTTTACAAAGTCTTTGGCTTCAGCAGAGAGAGTAGGCCATGGGGCCTCATCAAAACT
TGGTTCCGCCTTAAGGACAGCTCGGAATATTCCTGATTCTGTGCGTGCCCAGAAAGGTCGGCTCCCACAAAGCAAAATGTAGGCAATTACTCCAATGCTC
CACATATCTCCCTCCGTGCCATAAGATCGATGAAGCACCTCGGGAGCAACATAATACGCACTTCCAACAATGTCATTGAGTCTTTCATCTGGCTTTACAA
AGTCAGACAAGCCAAAGTCTATGACCTTCAAGGGTGA
page-top