Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29488  (registered. 2012)
Contig Information
Length 822 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435058|ref|NP_001042287.1|| Os01g0194600 [Oryza sativa (japonica cultivar-group)]
Score 183
Evalue 2.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29488
AAACAAGTGGGCAAGCAAAGAGGGTCTTTTCAAACAGCTAAGTTGCTGATGATGTCTGCGAAACTCAACACAGCTGGAGTAGTCCTAAGTAAGGTAATAA
TCACATTTAGGTCCAACCTTTTTTGTCACAACACCCCCGCTAGAGTTCATCTCGTTGTCTTTCCCACCCGTGCGGTACAGCTTATTTATCCTGTTGTTTC
TCACTCCACACCCTTGATAGTCTTGAAATTACAAAGCTCATGGTTTCCATATGTACATACACGGAGACGAAGACGAAGACGAAGCGTGCACGCACACGTG
CAAGAGAGTCGCCGGAGATGGGGAGGAGAGGATCCAGCAGCTGCTAGCTAGGCGCGGAGGGCTCCGACCTCTCGGAGGCGTGGGACGAGGAGGCCGCTGA
GGTGGAGCCCCATGAGGCCCTCCAGGCCGCCCACCGGAGCGCCCCCGACGAAGAGCGCCGGCACGGCCGCGTGGCCGCCGGCCTCCACCGCCGCGCGCTC
CTCTGCGGGGCCCTCCAGCTCGATGACGGTGGCGTGCGCGCCGACGGCCGCGAGGAGGCTCTTCATCACGTGCGCCATGTAGCAGCCGCGGCGCGCGAAG
ATGACCACGGGGCTCTCCCTGACCAGCCGCCCGAACCGCTGCGCCGGCGCCTCCTCCTCCCCTGCCGGGTCTATGGTCAGCCCCCGCCGGATGCCCGCCA
CCGCCTGCATGCTCGCCTCCCGCCGCCGTGAAGAAGTGACACGGTGAGGTAGGTCGCCGCGGCCACTGCTTGCAACTAAACTAGCAGACGACGGGTGCCC
ACCGTGAATGAATATCAATCGG
page-top