Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29484  (registered. 2012)
Contig Information
Length 1104 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218195958|gb|EEC78385.1|| hypothetical protein OsI_18163 [Oryza sativa Indica Group]
Score 214
Evalue 1.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29484
AAAAAGCAAAAAGAAAGCACAGAAGACATCNNNAGACCCGACTAGTATTAACTCAGCACATATTTTTGTATTCCATACCAAAATACCAATCACTAGATGC
CAATTCAGCGTGTCCACGGCGATGTTGAAACCCTGCTTCCTTCTAAAGAGAAGGAATTCAATTATCCAAGATACAACCACCAGCGGCAGCAGCAGGAATG
ATTAGACTCCTTCATACCCACCTCTCAAGCAGAGGCCTTGTCAAACTTGAGGGGCTTCACAACCTCCCAGGTGAAGTCAGCATCCTCACGGCCAAAGTGG
CCATAAGCGGCCGTCTTGATGAACCTGTTGCCACCCTTCTTCAAGTCAAGGTTGATGCTGATCATCCCAGGCCTGAAGTCAAAGTTCTCCTCCCCCCCAC
ACCTCGATCCCGCCGCCGCCCCACCCACCATGGCGCGGGCGAAGCCGTCGTCGGCGGCGGCGAAGAAGAGCCAGGCGGCGCAGCAGGGCGGCGGGGCCGG
GCACGCGGCGCCGTCCGGGCTCGCGCGGTACCTCGACCCGGAGGCGCCGTGGGACAAGGACCGGCTGCTGGACGCCGTGCACTGGATCCGCCAGGCGGTG
GGCCTCGCCTGCGGCCTTCTCTGGGGCGCCGTCCCGCTCGTCGGCGCCGCCTGGATCGTCCTGTTCGTGGCCATTTCTTCTGGCATAATTTACTGGTACT
ATGCGCACCTATTGAAGGTCGACGAGGAAGAATTTGGAGGCCATGGCGCGCTGCTTCAGGAGGGGATGTTTGCATCTTTCACCCTTTTCCTGCTTTCATG
GATTCTTGTGTACAGTTTGGCTCACTTTTGATGAGAAGCTCCTTTGTTGAACATACCTTGATTTGGGATCGGATTGGCGGAAAAAAATTCACCAGAACTC
TGTAGATTATTGAAGAGCCCTAGAACAGCATTGTATGAAATCGGTTCAGGCAGTCATGTTGTCTCTGAATCCCAGTGTAATTTTGATAGAACATCTTAGC
ATACCAGTTGTTGGCAGAACATGTTCAGTATGCTTGACATGTAACTATTGGATATCATTCTCTTGCGTCGATTCAATAAAATGTTTTAACATGTAAAAAA
AAAA
page-top