Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29482  (registered. 2012)
Contig Information
Length 1013 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222641915|gb|EEE70047.1|| hypothetical protein OsJ_30005 [Oryza sativa Japonica Group]
Score 454
Evalue 7.00E-126
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29482
GGCATCATCATACAAGACAAGATCAACCTTAAACGTTCACAAAGACTTTTAAGTCAAATTATAAACATGTCATACAGAGCAAATGTGGACTTCAGTCATA
TTCGGATCAAACGCTCACAAGGGCTGAAACTGTTTCAGCAGCACAGTTTGCTTCGTTTCCAAGCTCATGGCCTACCATGTTCCTACAGCACCCTTGGACG
GGTTCTCAAAGGCGGCAAACCCCCAGTTGGTCTTCAGAGCATACGGCGGGTAGATGGTTGATCCCTCGGTCGTGATCTTGGCAATCTGGAATTTGTTGAT
GGATGACCGGTCACGGTACAGCAGGACCAGCAAGCACTTCTCAATCAGCTTAACGGCTTCTTCAAAAGTCATGTCCTCGCGCCATTCACCACGAAGTATT
GGGATTGCCATATGGTTCCCAAATCCAGTGGCAATGTGGTTCTCCTCAAAGTGTGTACCAATCATGTTAACCATGCCAAGATACTTCTCATCGCCCTTTG
GGCCCTTTTTCACTCCACCAAGCACCAGGGAGTTCCATAGAGGGTCAAACTTATTGCGCCTGTTGTACATTACTCTTGTCAGGTAGGCATGGATTTCCTT
GGGGCCCAATGAGTTCCCATCATCCCACATATGATCATTCAAAGTTAATTCATCCAGATAGCGCAAAATCTCCTGGAAATCACTGAACTCCCCACTCCCT
CCAATAAGGCTATGCTTTCCAACCGCCTTGATACGCTCCACACTCTTGTATCGCAAAGTTGACCCATAGGAGGCTCCAGTATCACATGCCATGATCACAC
CATCCTTGTATTTCATTGCAATCACCGAGTTACCAGTCACATAAGGGTTCAGTGTCCTCTGCGTCCCATCTCCTCCTCCGGCCGCCGCCGCGGTCGCGTC
CATTGGTGCGCGTGGGGGGTTGATGCGGCTTGGTTTCGCTCGTCGGAGGAAAACCTCGGCTCGGCTGCGGCTGGGGATGGTGGTGTGGCCCTCTCTCCCT
GTATCCTTTCTTC
page-top