Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29479  (registered. 2012)
Contig Information
Length 1166 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115475858|ref|NP_001061525.1|| Os08g0320100 [Oryza sativa (japonica cultivar-group)]
Score 523
Evalue 1.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29479
CCACCCACCAGCCTAGGGCTCCGGCGAGATGAAGCAGCAGGATGGAGCTAGCCCGGCCAAGATGTTCATCGGCGGGCTCTCCAGGCAGACAAGCATGGGT
ACGTTCAAAGAGTACTTCGGGAAGTACGGGGAGATAATCGATGCGGTAATAATGAAGGACCGCCATACCCAAAAGCCTAGAGGCTTTGGATTTATTACCT
ATTCAGATCCTGCTATTGTTGACAGAGTGATTGAAGATAACCATGTCATTGATGGCAAGCAGGTCGAAATTAAAAGGACTATCCCGAAGGGTGCTGCCCC
CCTGAAAGATTTCAAGACAAAGAAGATTTTTGTTGGCGGATTGCCTACTGCTCTAACAGATGGTGAATTCAAGGACTTCTTTTCAAAGTTTGGAAAGGTG
GTGGAACATGAGATCATCTGTGATCATTCGACCAACCGGTCACGAGGATTTGGATTTATAGTGTTTGATGCAGAAAAAACTGTAGATGAATTGTTAGCTA
AGAAAGGCAATAAGATTGATCTAAATGGTACTCAGGTGGAGATCAAGAAGGCAGAACCAAAGAAACCCTCTAACCCACCTCATTCACTTGATAGCAAACC
TAGGAGATCTCCTTATGCAGATGGTTATGATGGATTTGCCAGCCGTTACAACAATGGTGGTCGCCTTGCCCCCTATAAATCACCTGGTTTTGGCGCTAGG
CCTGGCAGCTACAGTAGTGCTTATGTTCCAGGCAGCTACAGTAGTGCTTATGTTCCTGGTGACTATAGTAGCGGCTATGGTGGTTATGATGGAGCATTTG
GAGGTTATCATGGAGAATCGTCTTTCTACTCCAGTCGTTTTGGTGGCAGTTATGGTGGTGGTTTAGGTGGTGCATATGGGCGTGATGCTGTGCCTTATGG
CACGTCTAGCTATGGGCCTAGTTATGACTCTTCAGGTGCCAGTGCCGATCCTAGTGTTAGGTCTGGCATGGTTGGACTCTATGGTGCTAGGGGAGGCTAT
GGTAGCAGCAGTGGTGGTGGTGCTACTGGTCGCTACCATCCATATGCAGGGTAAGCCTGTGGATGGTCAATGCTAGATGAGAACTTAAGAGATATCACCT
GCAGCTAGAAGAACCTTGTGATCTGCTTAGTTTGCTACTCCATGGTTGTAGAACTTAAAGACGTTG
page-top