Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29473  (registered. 2012)
Contig Information
Length 2146 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222641829|gb|EEE69961.1|| hypothetical protein OsJ_29849 [Oryza sativa Japonica Group]
Score 1138
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29473
GTTATGAGTTTGCTCCTCTCACAATTTATCCGCAATTCGAACAATTGCCAAAATGTTACAGGTATCGTCGTAGCCCTCTTAGAAACCTAAGCAGACGGAG
GTAGGATAAAGATATTAACTTCCTAAACTGGGTACACAAAAAAGTAGAAGAAACCTGATGCAGAACAAATCTACATCTTGGCCTCCTTGGGGTCCTGGTA
TTCAGCTTCCGGAGTCTGGTCGCCACCACCACTGCTGCCGCTGTCGCCGGCGGCAGCGCCGCCACCACCCTGCATGTGCTGTCCAATCTTTGAGACTGCC
TTGTTCGCCGCCTCCAGCTTCTGCTTGATGGCGTCCGAATCGTCGCCAGCCATTGCTGCTCTCAGATCAGAGACAGCAGACTGGATCTCCGTGACAACTT
CAGCAGGGACCTTGTCTTTGTACTCGCTGACGCTCTTCTCAATGCTGTAGATGGTGGTATCTGCAGAGTTCCTGAGGTCAATCAACGACTTCCTTTCCTG
ATCCCTCTGAGAATTTAGCTCCGCCTCCTTCACCATCTTCTCGATGTCACTGTCAGACAAACCACCTGAAGATTTGATGGTGATATCCTGCTCTTTGCCA
GTGGACTTGTCCTTTGCTGACACCTTGACAATACCATTGGCATCAATGTCAAAAGTGACCTCAATCTGTGGCATACCCCTCGGGGCCGGTGGAATGCCTT
CAAGCTGGAATTCACCAAGAAGCTTGTTATCTGTGGCCATCTCCCTCTCACCCTGAAGCACCTTGATTCCAACCTGCGTCTGGTTATCTGCAGCAGTGGA
GAAGGTCTGGCTCTTCTTGGTTGGAATTGTAGTGTTCCTGTTGATTAGCCTTGTGAAGATGCCTCCAAGAGTCTCAATACCAAGGGAAAGGGGCGTGACA
TCCAGCAGCAAGAGCTCCTTCACATCACCCCTCAAAATGCCACCCTGAATGGCAGCTCCCATGGCAACAGCCTCATCAGGATTGACACCCTTGCTTGGCG
ACTTGCCGAATATCTGAGAAACAATATCCTGGACCTTTGGCACCCTTGTCATACCACCAACCAGTAGAACCTCATCAATCTCCTTTGCAGAAACACCAGC
ATCCTTGAGGCAGTTTGTACATGGGATGCGAGTTCTCTCAATGAGGTTGCCCACAAGAGACTCAAACTTTGATCTGGTCAAGGTAATGTTGAAATGCTTC
GCACCAGAGGCATCTGCTGTGATGAAGGGGAGATTGATTTCAGTCTGTGGAGTTGAGGAAAGCTCAACCTTCGCCTTCTCAGCAGCTTCCCTGAGCCTTT
GCAGGGCCAACTTGTCCTTGCTCAGATCAATGTTGTCAGAGTTCTTATATTCACTAACCAGGTAGTTGAGCAATGTAGCATCAAAGTCCTCACCACCAAG
GAAAGTATCTCCATTGGTCGCCTTGACCTCAAAAACGCCATTAGAAATCTCAAGGATTGATACATCAAATGTTCCACCGCCCAAGTCAAATACAGCAATC
AGGCCCTCCTTGTTGTTCATTCCATACGACAGAGCTGCAGCAGTGGGCTCATTGATAATCCTCATCACCTCCAACCCAGCAATCCTACCAGCATCCTTGG
TGGCCTGACGCTGGGCATCATTGAAATAAGCTGGGACTGTAATAACAGCCTTGGAGACCGACTTGCCAAGGTAAGCCTCTGCAGTTTCCTTCATCTTGGT
AAGAACAAACGCACCAATCTGACTCGGGGAGTATGACTTCCCAGCCATCTCCACCCAGGCATCACCATTTGTTCCCCTGACAATCTTGTAAGGCACCATC
TTCATTTCCTTCTGTGTTTGGGGGTCATCAAAAGCTCTACCAATCAGGCGCTTGGACCCACGAACTGTGTTCTCGGCATTTGTCACTGCCTGTCGACTGG
CAGTGATGCCAATCAAGATCTCGCCTTTGCTGTTTGTGGCAACAATGGAGGGCGTTGTCCTCGCACCTTCAGCATTCTCAATCACCCGTGGTGTCTTTCC
TTCCATGACGGAGACACATGAGTTCGTCGTGCCCAAATCGATCCCGATGACATCGGCGGCGGCGGGCCTTGAGCTGAAAGCGCGGGCCACGGCTCCGATG
GCCATGGCTGGCGCTCGGGCTTGTTGGGTCGGCTCCCGGCGGCGGC
page-top