Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29472  (registered. 2012)
Contig Information
Length 825 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_OKCS Seed DPA5 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115474735|ref|NP_001060964.1|| Os08g0139000 [Oryza sativa (japonica cultivar-group)]
Score 240
Evalue 2.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29472
ACGAGTCATTATCCAGTAGTACAAGAGCAGCACATGCCATCAGCAGCTGATAAGGCTTACGACAATTCAAATAAAAGGGACAAGAAGACATTATTAGCAA
TGGTCCGAAGCTGTTGCATGCTGACAGTAATACCTGCTCGGTCCATATAAGGTTCCCCTAGTGCTTCTCCATGTGGAGGCCGTAAACGACCAGTCCAACA
CGACAAGAATATTGGATCAGGCAAGGGTGTTCACACCTGGGACAACACCATGGTAGCTATGATCTAAATGTAGACTGCGATGGCTGACTGATACGCTGTC
AGACGCACAGCCAGGTAGAATGATTGTCCCTTCATCTACTGTGAGCCCCAGGAACCAGAAGGAGTGCCCCATGATTGTTGTGGCTGCGGAGTTGCCCCTC
CCATCTGCGGCGGTGGTCTGGGTCTAGCATATTCGGCAAAAATAACCCATCCATCCAGAAATTTTCCATCCATTCCTTCTATTCCTTTAGTTGCATCTTC
AACCGAAACATACCTTACAAAGCCAAACCCCTTAGAAAAACCAGTGACACGATCTGTGACAACTCGAGCGTGTTCAACTTCCCCAAACTTTGCAAAAGCT
TCTCTAAGTCCATCAGTTGTTGTACGCTTGCTTAGCCCGGAGACGAAGAGGTTGGGGGAGGGGTCGGCCTTCGGGGGAGGCGTGGGCGGGCTCGGCGGCG
CGAAGGCCGAGATGGAGAACATGCGCGTGTTCGGCGCGAAGTCGGCGATGGAGAACATCCGTCGGAGCCCGGACCTTGCCGCCACCGCCGCCATAGCTGC
CGCCGCCGGAGAATGGGGGAAAAGG
page-top