Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29471  (registered. 2012)
Contig Information
Length 1062 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|38605539|sp|Q41542.1|XTH_WHEAT|XTH_WHEAT RecName: Full=Probable xyloglucan endotransglucosylase/hydrolase;
Score 613
Evalue 1.00E-173
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29471
GAGAGGCCGGCCGGCGAAATGAAGGCGACCGCGGGGGCCCTCCTCGCCGTGGCGGCGGCGGTGCTGCTGCGCGGCGTGGCAGCAGCGCCGCCCCGGAAGC
CGGTGGACGTGCCGTTCGACAAGAACTACGTGCCGACGTGGGCGCAGGACCACATCCACTACGTGAACGGCGGGCGGGAGGTGCAGCTGTCCCTGGACAA
GACCACCGGCACGGGCTTCCAGACCCGGGGCTCCTACCTCTTCGGCCACTTCAGCATGCACATCAAGCTCGTCGGCGGCGACTCCGCCGGCACCGTCACC
GCCTTCTACCTGTCGTCGCAGAACTCGGAGCACGACGAGATCGACTTCGAGTTCTTGGGGAACAGAACGGGGCAGCCGTACATCCTGCAGACCAACGTGT
TCTCTGGCGGCAAGGGCGACCGGGAGCAGAGGATCTACCTCTGGTTCGACCCAACCAAGGACTACCACTCCTACTCCGTCCTCTGGAACCTCTACATGAT
CGCGTTCTTCGTGGACGACACGCCGATCCGGGTGTTCAAGAACAGCAAGGACCTCGGGGTGCGGTACCCGTTCGACCAGCCCATGAAGCTCTACTCCAGC
CTGTGGAACGCGGACGACTGGGCGACCCGGGGCGGGCGGGAGAAGACGGACTGGTCCAAGGCGCCCTTCGTCGCCTCCTACCGGGGCTTCCACGTCGACG
GCTGCGAGGCGTCCGCGGAGGCCAAGTTCTGCGCCACCCAGGGCGCCCGCTGGTGGGACCAGCCCGAGTTCCAGGACCTGGACGCCGCGCAGTACCGCCG
CCTCGCCTGGGTCAGGAAGGAGCACACCATCTACAACTACTGCACCGACCACGACCGCTACGCCGCCATGGCGCCCGAGTGCAGGCGCGACCGCGACGTC
TGAGCCAGCGACCATGATATAGTACTACCAGTTGTTGTGCCGCTGGTCGCGGTGCGGTCGGTGAGACGTAGTAGTACGAGGAATTTGTATCCCTACACTA
CATGTGTGTATGCTCATGCCTACTTTATTAATATTATTTTGATTGCCCATTCAAAAAAAAAA
page-top