Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29470  (registered. 2012)
Contig Information
Length 1257 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|223974653|gb|ACN31514.1|| unknown [Zea mays]
Score 382
Evalue 4.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29470
CGCCGCCGGAGAGCGGCGCCTCCTCGCTGGCCTCCTCCTGCTGGCCCTGATGGTCTCGGCGCACTGCCTGGATGGCGGGGGCCACCACGGCCCGCGCGTG
AAGCGGCGCCGCAAGAAGCGCGAGATCCACTCCCCGGTCAAGACGGTGGTGGTGGTGGTCATGGAGAACCGCAGCTTCGACCACGTCCTCGGCTGGCTCC
GCGCCGGCCGCCCCGACATCGACGGGCTCACCGGCAAGGAGTCCAACCGCCTCAACGCGTCCGACCCCTCCTCCCCGGAGATCTTCGTCACCGACAAGGC
CGGCTACGTCGACTCCGACCCCGGCCACGGCTTCGAGGACATCCGCGAGCAGATCTTCGGCTCCGCCGACACCTCGGCAGTCCCTCCCCCGATGTCGGGC
TTCGCGCAGAACGCGCGCGGCATGGGCCTCGGCATGGCGCAGAACGTCATGAGCGGCTTCGCGCCCGACTCCGTCCCCGTCTACGCCGCGCTCGCCGACG
AGTTCGCCGTCTTCGACCGCTGGTTCGCGTCCGTGCCCACCTCCACGCAGCCCAACCGGCTCTTCGTCCACTCCGCCACCTCCCACGGCCTCACCTTCAA
CGCCCGCAAGGACCTCATCAACGGCTTCCCGCAGAAGACCATCTTCGACAGCCTCGAGCAAGGACTGGAGAGGTGGCAGGGCCGCAAGCTTTAACATCAT
TCCCAGCAGCACTGGTGCTGCCAAGGCTGTTGGCAAGGTTCTTCCTGAGCTGAATGGCAAGCTTACCGGTATGTCTTTCCGGGTTCCCACTGTGGATGTG
TCAGTTGTTGATCTCACTGTTAGAACCGAGAAGGCTGCATCATACGATGACATCAAGAAGGCTATCAAGGCTGCATCTGAGGGAAAACTCAAGGGGATCA
TGGGTTATGTCGAGGAAGATTTGGTCTCCACTGACTTTGTCGGTGACAGCAGGTCGAGCATCTTTGATGCCAAGGCTGGAATTGCTCTGAACGACCATTT
CGTCAAGCTCGTCTCGTGGTACGACAACGAGTGGGGTTACAGCAACCGCGTTGTCGATCTGATCCGCCACATGGCCAAGACTCAGTAGAGCGTTCTGATT
TCCTTTGGTCAGAGGTGTCCCTGCTTTGTCTATGCGAAGAATAAATGTGGATGGTGTCGCCAGACGACGCCTGGTTCATGTTAGTTGGACATGAGTTACC
TTCTGTTTTCCGCATCAACTAGTACTTCTGTAATGGAGTTGCTAATCAAGTACTCTT
page-top