Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29469  (registered. 2012)
Contig Information
Length 1737 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_VSCB Liquid cultured tissue 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115447523|ref|NP_001047541.1|| Os02g0639700 [Oryza sativa (japonica cultivar-group)]
Score 645
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29469
CAGGTTTAAGACTGCAGCTAAATCATCTCAGCCAAATCATAATGTTTAGGCCGCCAGAAATATCTCCTGTGTGAACAAAAAGGAATATGCAACGCACTCC
CCATCCTCCATATCCCAAAATGAACAGAAAGCGCCTGGATTCAAAACGGCACCAAATGATAAAACTAGCAGCTAAGAGCATCTTCTGTCAGCTTGTGTCG
GACGACCTTTGTACACCAAGCTATACTCACTGGTCTTTCACTTGATTAATCGGAATGAGAATGGTCCCAGGATTGGCCTCATCTTCGGTCCACTCGACTG
ATTTCTTCTCCAGAAACTTCTCAACCTTCCTTCTTCTTTGTCCCATCTTGAAAGTGCCATCGTCAACACCAATAATAACTCTCAAATTATCAAAAGATGG
GATGTTAGCCAACTGCCTAAGATGAAGTCTCAGAAGATTTGCTACGTTTGCTGCATCCTGTGAGCGCAGATCAAGACATAACTCATTTTTGGACTCTTGT
TTGGACTTGGTGATCTCAGCAGCCGATTTTTCATCAGATAATCGAGCCATCCTATAATAGTTCTTTCCTTCTGTCATAAGATACTCGGCTTCTTTCTTGT
TACCCTCCCTAAAAGCATCAACAGCCTTCCCATAGTACTGCTTCATCATATCCCAGTGCTGCTTTGCAGCCTTACGATAGTTCTGGTAATCATCCTCATC
ACGCACAACTGGTTCTTTGCTGCCTAGGATAATTTTCACCGGAAGATCCATAGAGGGTGGTGAAATGTCCTCAAGAGGTTTTACGACTGGTTTCTGATCT
GGAACTCTCCTTCGATTTGCGCCCAATTCATACCGCCTTACTTTTGGTTCCTCCTCAGATCTTTCAGGTGCAGTGAATATTGATTCTAGTAACTCTCCAG
GGGTAATCTGTGGTCTAGATGTGGATTGTGATCCTAGGCAGCTCCCCGTGGAAAAAGAGGATTCTACCGCCGTGTCTTGTACTGCAATATGCTCATTCTC
TGGCCTTTTGCCCAGATCTTTTGTAGAAAATGACATTAATTCCTCCATGCTCTTCTTCATGTCGTACCCACAGCTGCCTAGAACATCACGGATCACTTCC
ATGTTGAGCTTAAATCCTTCTCCAAGCATAGAAAATAGGAATTCCTCAACATCTCTGTTATTCAAAGTCTCTCTCTTTGGTGCAGAATCAGATTCATCTG
TTTTCAAATCATCTCGCATGTACTCTGGCAGTTCAACCTTTATAGGTTTTCCTTTTCCTGGTGCTGTATTGGCAGGAGCTGTAGTAGCTCGGGCAGATCC
TTTTCCTAACATGCTGGATACAGTGCCAAATGAAGCACTAGACTTCTGTGACTTCTCACGTGTTCTTGTTTGGCTTGAATTCTCCACAGAGCTTTCTTCA
GCTGCTTTCCCGACACAGGAAAGATTCCTTGTTTGGTTTGAGTTGTCCAGAGAATTTTCCTCAACTGCCTTACCAAACTGGGGAAGATTGGTCTCAACGC
TCGAGTCAACTTCATCACTCTGGGGCATCGAAAGTTGAAGGTCAGTCAAGAAATCCCCAGCTTTGTTGACATTGCCATTTGCTCTGCAGTATGCATTGGC
TATATCTTCAAGTGAAAAGGCACAACTGAAAGCATCAAGCAATGCATTAAGTGCCCTTGTCTCTTCATCACTGGTTGAAGCCAGTGAACTGGAAAGATCC
ATGGTGAGGACCCTCGGGTTTGGGAAGACGGCCGCGC
page-top