Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29463  (registered. 2012)
Contig Information
Length 691 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125570422|gb|EAZ11937.1|| hypothetical protein OsJ_01810 [Oryza sativa Japonica Group]
Score 419
Evalue 1.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29463
AAGGTGGAGAAGGAGCTTAAGGAGAACCCTGCACCATCAGAAGCTGACGTTGAGGCTGCTAAGCTTGTTGTTAAAGAGAAAGGAGATGCAGTTGCTCAAT
TGAAAGCAGCAAAAGCTAGCAAGCAAGAGATAACTGCTGCTGTTTCCGTGCTTACAAAAGCTAAAGAGAATGTGTTAAGGGTGGAAGAGCGCTCTAAGTT
GAAACCTGGACTTCCACTCAAGGATGATGGGAAAATTGCGTTTGAGAATGACTTCTTCAAGCGTCAAGCTTTTCTGACCGTTTCAGGCCAACTTCAGGTC
GAAACTTATGCTTGTGCTCTCAGTAATGTGTATACCTTTGGACCAACATTCCGGGCAGAGAACTCACATACATCAAGACATTTGGCAGAGTTTTGGATGG
TTGAACCAGAAATTGCATTTGCAAACTTGCAGGATGATATGAACTGTGCTGAAAGGTATGTACAGTACCTGTGCAAATGGTTACTCAAGCATTGCCGAGA
AGACATGGAATTCATGGTTAAACATGTGGACAAGACCGCAATTGAGCGTCTGGAGCTTGTTTCCTCTACTCCGTTTGAACGCATTTCATATACAAAGGCT
GTGGAGATCTTAGAAGGTGTAGATAAGAAGTTTGAGAACAAGGTTGAATGGGGAATTGATTTAGCATCTGAGCATGAGAGGTATTTGACTG
page-top