Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29384  (registered. 2012)
Contig Information
Length 1226 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242048484|ref|XP_002461988.1|| hypothetical protein SORBIDRAFT_02g011950 [Sorghum bicolor]
Score 530
Evalue 1.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29384
TTTTTTTTTTAATTCCACGAGACAATGTGTCTACATGAAGAGCGTCGAATGGGGTACACATAAATCACGAGTCGATCGACCGACGGATCTCTACAATTTC
AAATCATTTGATGACCAGATATACAGATCATGAACTCCTGATTAATTTTTGAGGAGCTCCATGACGAAGGCGACCACCTTGGCCTTGTCCACCGTCCACG
CCACCGAGATGGGCGTGTAGCCCGACCACGCGTTCTCCGACTTGAACTTCTTGAGCCCCATGTCCATGGAGGTGTGGCCTCTGCAGATGCCCTGGGTCTC
CACCCGCACCACGCCCTTCCTGAAGGTGAAGAGCTCCGGCCGGACCAGCGCGGCAAGGCTCACCGGGTCGTGCAGGAACACGGCGGGGTCGCCGTACGAG
TGGAGGTGCCAGTCGCTGTAGAACTTGCAGATGTCGCAGAGGAACTGCGCCTGCTTGCCCCCGGAGCTCCTCAGCTCCGACAGGTCCGCCTCCGTGAAGC
TCACCTGGGTGGTGATGTTGAGGCCGACCACCGCGATGTCCGCGCCCGACGTGAACACCATGTCCGCCGCCTCCGGGTCGCTGTGGATGTTTGCTTCGGC
CGAAGGCGTGGCATTTCCTGCTGCGAAGAAGGCTCCGCCCAGCACCACTATCTTCTTCACCTTGGTCACGAAGGAGGGGTCCATCTTGATGGCCAATGCG
ATGTTGGTCAGAGGGCCCAAGGCAAGCACGGAGACCTCCCCCGGGAACTGCGACACCTTGTCGACCAGAAACTCCGCCGCAGTTTGCTCTGCTTTCTTGG
TGGTGGGAGCAGGGACAGGTACGTTCCCGAGGCCATCGGATCCGTGAACAAAGTCTGCAACTTGCGGCTTCCCTCCCTTGAGAGGCTCGGCGCTGCCCTC
CGCCACCGGTACGTCGGGATGGCCTGCCTTCTCACACAGAATCAAGGCGTTGCGGGTGGCGTATGCGGTGGTGCAGTTGCCGAAGATGGTGGTGAGGCCT
AGGACCTCCACGCCCGGCGCATGGAACGCCATCATGATCGCCACGCTGTCGTCTATGCCGGGATCGGTGTCGATGATGAGCTTCATCGTCTCCTCCGCCG
GCTGGATCTGGTGCCCGTTCGCCGCCCGGTGGGTGGGTGGAACCTTCCCTCCGTCGGTCACTCTGTCTCCTCTGCNNNNTTCCGTCCTCTCTGTTTGCCC
TGTCTGTCTGCCTCGTGCCGAATTCC
page-top