Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29320  (registered. 2012)
Contig Information
Length 1007 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 4
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242035885|ref|XP_002465337.1|| hypothetical protein SORBIDRAFT_01g036710 [Sorghum bicolor]
Score 352
Evalue 3.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29320
ATTCCAGCGAGTACATATATAGGACAGATTAACGTGCTCTTTATTTCCGGACTAGAATGACATTCACTCTTAGGTCTTAACAGGAGGCAAAATGACGAGG
CACATAGCTTAAGCCTTTCTTATGTGTGCACATGAAAGATACAATAGTGAACAATGCTCAACACAAGCAATAGTAAATGATAGGGGGAGTCAACGATGGT
TGTGCGAGTAATCTTGATCGCCCCGTATTCAAATGCTAACAGAAACAAGGTTATAATCCATAGAAGATGCTGCCTGTGTCTTAGTGAATTGAGTTTATTC
CATGGAGGGGCCCAGGAGCGGTTCTATGGCGAAATTCAGACGCGGACACCATATTCAGATATACGGTTCACCCTTTCTTCCAGGACATGTCTCCTGTTTT
TCAAATCAGAGGCCATGGAAGCCACCTCTGCTCGTAATTCAAGAGACTGTCTTGTAGGAATAATTCTTAGTTGATCCATCAAACCTGCAGCTGTTGATTC
TGCTTTGTAAATAGATCTTATAACGGACTGGATTTGCTTACCAGTAGATCTCAAATCAGTTCGGCCACGCTGCAGATCACTTTCACCAATGACTACTTTG
TCCAGGGTGTATTTGGAATCCTTTCTCAAGCTCTCAATAGATGTTTTGTATTCGATCATACTTTGTTCAACATCATTCAGTAAATCCTTCTCAGTTTTAA
AACGACCCAGAGTATTGCGGTATAAAAATCTCCGAGGGCCTCTGAACAAGATGAACCCTGCGACAGTGGCACATCCAATTGCCTCCGCTTGATGCTCGCT
CGCAAGAACTAGCGCATCCGAAATAGTAACTTTAGCCCTCTCCACTAACACATCCTCGTAGGCTTTGTACTGTGGCCACAACCCTGGCGCAAAGCTCTGG
AGCTTGCGGAGAGGCCAGGGGGAGGCGGAGGCGGCTTCCGCGCCTTGCGACGGCGTGCGGCCGGTTTCCGATGACGCCATCGACTGGGCTCCTGCAGTTT
CTCCGGT
page-top