Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29312  (registered. 2012)
Contig Information
Length 1515 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242086967|ref|XP_002439316.1|| hypothetical protein SORBIDRAFT_09g004260 [Sorghum bicolor]
Score 622
Evalue 4.00E-176
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29312
CTCGAACATGCAAAAAATGAAAGAAAAAACAAACAAGGTCATAAGAACCTTGGAGACCTTCCCTCACAGACCACAAGATTGTAAGTAGAAGTGTAGAACA
AGTTGGTAAAACGTCACGTCACAAACATAAGGCAAATAATAGATGCTCACAAACAGAAGCTATCAACATCCACTGGCAAAAATGTACCACAAAAGTAACT
TACAAAAACAGATGCCGCGCAACCAGGAAGAACAACCAGAATAGGTGGTGCTGTTAAATCCGGCCTAATTCTGTACAGAGAAAACGAGTGCAGAGCCAAT
GGACATTTACAAATGCTCGGCAACTAAGGGTGGTTAAGCAAGACAATTGGCTGGTGGATGAATATTGCCATGCCCTGGTGGATCCAAACAATAGATCAGA
TCACCCCCTTCGAGCTGACGATGCTAATATTCAAGGAATGGATGTTGATCAGATCAGGCACTTCCCCCGGTTGCTGGCTTATTTGGAATTTGTCTTTTTA
CCCGCGATGTGCCTGTTTCATTTGGCTTCAAGATTTGAAATGAGCACATTAGATCTTCATCTATGCTCAACAGAGCACCTACATTATCGAATTCCCCGCA
GTAATTTGGAGCTGAGAAGATGGTGACTAATCTCCGCTGTGCGAAGAACTCGTAACCATCTTCTACCACCTGATGGGCTCGGCAGATAAGATCAAGATCA
TTTTTTTCCAAGAACTCTATAAGCTTATCTGCACCAAACGTACATGAAACACCTCTGTCACTCTCCCCCCACCCTTCTCCGTCAGGGCTAGGATCAGACC
AAAGCAAATCACACAGGAGACCATAATCAGGAATCTCAGCCGGCCTCTCAATATCCTTTATTTGGTCCAGGTTAGTCAGTTCAGGTGAAAGGCCACCATG
CATGCACAGTATCTTGTCGTCAATGAGTGCTGCAATAGGCAGGCAGTTGAAGCAATCAGAGAATATCTTCCACAGTCGAACATTGAACCTCCTCTTGCAT
TCATCATAGAAACCATAAACTCTGTTGATTTTTGCATCTTCATGGTTACCCCTTAACAGGAAAACCTTGTCAGGGTACCTTATTTTGTAGGCCAGCAGTA
AGCATATAGTTTCCAAGCTCTGTTTGCCTCTATCTACGTAGTCTCCGAGGAATACATAGGTTGAGGTTGGAGGATAACCACCCAAATCAAACAACCTCAG
AAGATCAACAAACTGACCATGGATATCACCGCAGATCTTGACGGGGGCCTGGATGCGGAGGAGGTTCGGCTGGGACAGGAAAACCCGCTTGGCGTCGACG
CAGAGCTGCCGGATCTCCGCCTCGGACAGCTGCACCTGCCGCCCGCCGCGGCCGCCCTCGACCAATCGCCGCACCACCTCGTCCAGCGCCGCGCCCTCCA
TGGCCCCCATGGAGGCCCGTGTCATCATCATCTTCCCTCCTTCTTCTCCCGCGGCCGCGTCCCTCTCTCTCTCCGGCGACGGCTAGGGGCGGGGGAGAGA
GAGAGGAAGGGTGGG
page-top