Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29298  (registered. 2012)
Contig Information
Length 1009 bp
Clones alternative view 79 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 4
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 5
Wh_VSCB Liquid cultured tissue 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 3
WH_XA Root 1
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XF Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242066288|ref|XP_002454433.1|| hypothetical protein SORBIDRAFT_04g030890 [Sorghum bicolor]
Score 314
Evalue 9.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29298
TTTTTTTTTTGAAGAACAAACTTTTAACCACTGAATGGTATAGATTAAGTTAACCCAAGTGCACAGACTACATTGCAAAGACCAAATATGCAGTAGTAAC
AATGAGGTCTCACAGGATTACTGCTAAAACATGACAAAAAGAGGAGGGATCACATCGTTTGGAAGGTACATAAGCAACATGGTATGACTTCCATATCATC
AGAGATGATAATCACCTCGACATCAGGTCTTTAAGCGGAGGGGATCTCGACCTCGCCGTCGTCGATCTCCGTCTGCAGGTCCTTGGGGTCCTTCCCGTCG
ACGGTGCAGCCAACGCTGACGCAGGTGCCGAGGATCTCCTTGACAGTCCCGGCCATCTCCTTGGCCATGGACCTGGGCTTCATGATCTTGGCGATCTCGA
TGACGTCGTCGAGGCTGATGTTGCCGTTGTGCTTGATGTTCTTCACCTTCTTCCTGTCCCTCTCGGGCTCCTTGAGGGACTTGATGACGAGCGCCGCGGC
GGAAGGGACGACGGAGACCTTGGCCTGACGGTTCTGGACGGTGAGCTTGACGGTGACGCGGAGGCCCTTCCAGTCCTTGGCCGTCTCCTTGGCGATGTCC
TCACCGATCTTCTTGGGGGAGAGACCGAGGGGCCCGATCTTGGGGGCGAGCGAAGACGCCGCGCCGACCTCGCCTCCGGTCACCCGGACGTAGACCTCCA
CCACCTGCGACGGGTCGAGCTTGGGCGGCATGGCTGCTGTTCGGTGGCGGGCGGCGGCGGCGGCGGCGGGAGGGTTTGGGAGAGGCTTGGCCTCGTGCCG
AATTCGGCACGAGGGACAGTTCGGTTCCTATCTACCGTTGGTGTTAAAGGGAGAACTGCGAGGAGCCAGCCCTAGTACGAGAGGACTGGGCTGGGTCAAC
CTATGGTGTACCGGTTGTTATGCCAATAGCAGCGCCGGGCAGCTAAGTTGGTATGGAAGAACTGCTGCGCCGCGGGAAATCCTTCTCTATACAAGTTCTC
GTACGAGGT
page-top