Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29294  (registered. 2012)
Contig Information
Length 863 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 1
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115461434|ref|NP_001054317.1|| Os04g0685300 [Oryza sativa (japonica cultivar-group)]
Score 307
Evalue 1.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29294
TCCCCTCCCTCCCTCCCGTCCAACAACCGCCGCAGTCAGCACCACCAGCTCTCACCGTCGAGCTCGCCAGGATGGGTTCGGGGAGCCGCGCGGCGTCGTG
CCTGTGCTGCCCGTTCAAGTGCCTGGCGTGCGGCCTCTTCAGCTGCCTCTGCAGCATCCTCGTCTCGCTCCTCGTCACCGCCGGCGTCCTCGCCCTCATC
CTCTACTTCCTCTTCCGCCCGCAGATGATCGCCGCCACCGTCGACTCCGCCTCCCTCGCCCAGTTCCAGCTCTCCCAGGCCAACCCCGCGCTGCTCCAGT
ACAACCTCACCCTCGCCATGACCGTGCGCAACCCCAACAAGCGGGTGGGGCTCTACTACGACGGCGTCGAGGCCCTCGCCCTCTTCGACGGCCAGCGCTT
CGGGTTCGCGCCCCTCGACCCCTTCTTCCAGGGCCACCAGGCGTCCACGGAGGTGAAGCCGGCGTTCGGCGGCCAGCAGGTGCTGGAGGGGGACGTCACG
CAGGCCAACCTCAGGTCGCAGCTGGCGGGAGGCGCGGTGGAGGTGGAGGTGAAGCTCAACGCCAAGCTCCGCGTCAAGGTGTGGGCGTTCAAGGTGCCCG
GGCCCCGCGCCAGGATCAGCTGCCCGCTCTCCCTCCCCGCCCCCGCCGCCGCAAACGCCCCCGCCTTCAAGCCCACGGAGTGCAAAGTCTGGTTCTGATT
CGATTCTCCACCATTGGGGAACCTGATCTGATCCGTTCTCTCGATTCGATTCCTTGGTGCGTAGGTTGGTTGCGCGATGCTCTTGCTGATGTGCGTCGCC
CGCCGTGGTTTATCTTGGTAGTAGAGATTTTCGCATCTACTGCTAGTAGTACTAGTTGGATTC
page-top