Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29256  (registered. 2012)
Contig Information
Length 782 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|13925731|gb|AAK49426.1|AF262982_1|AF262982_1 cyclophilin A-1 [Triticum aestivum]
Score 357
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29256
TTCAAACGGTAAGATAGCAGCAGACACAGGAAGATANNNNNGGCGGCCGGACAGAGATCCAGCAGCCCAAAGAGTCCACCTAAAACNNNNNTAAACCAAC
CACGGAGATCTCATCGGACGGACCAGGGGAAGACACGACACGACACACGACTCTCTTATTTAGATCGACGACACGACACGGGACACACGGGGCGGCGACG
ACGACGGCGAAAGGCGACCCGCGCGCGGGCGGATCTAGAGCTGGCCGCAGTCGGCGATGACCACCTGCTTGGAGCAGGTGCCGCTGCGGGAGCCCACCTT
CTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGACCACGTGCTTGACGTCGAGCCAATTGCAGGGGACGGTGCAGATGAAGAACTGG
GAGCCGTTGGTGTTGGGCCCCGCGTTGGCCATGGAGAGGATCCCGGGCTTGGTGTGCTTGTGGACGAACTTCTCGTCGGCGAACTTCTCGCCGTAGATGG
ACTCGCCGCCGGTGCCGTTGCCCCGGGTGAAGTCGCCGCCCTGGCACATGAAGTCGGGGATCACGCGGTGGAAGGCGCTGCCCTTGTAGTGCAGCGGCTT
GCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCACAGCGCGCGGAAGTTCTCCACCGTCCGCGGCACCGCGTCCTTGTACAGCTCCATCACGATGCGCCCG
GCCGGCGCGCCGCCGACGGTCATGTCGAAGAACACCCTCGGGTTGGCCATCTCGCTCGCCGGGATCGGGGATGAGGGCTAGG
page-top