Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29194  (registered. 2012)
Contig Information
Length 715 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226491968|ref|NP_001148529.1|| LOC100282145 [Zea mays]
Score 328
Evalue 3.00E-88
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29194
TTTTTTTTTTGTCAAGATATAGAAAAAGTCATGGATGGGAGTTTTCATCAACACAATTGGTTAATAGGCCGATCCGATAGCACAACAGATTTCAATGTAG
CATATCTAAGTAATTACATTGCACCTGTCAGCCCAGGTACAGGTATGCTCTAGAACTTGTCTATGATGATGCCATCTCTGACAACCTCATACGCATCGCG
GCTGCGGGTCTTCTTCATGCCGGCAGTGAAATGGACCTTTGAGCCCTCGGTCTTGATGGAGGTCACCTTGGTCCATACAAGCACCTTGGTCTTCATGCCC
TCGATGTCGGAAAGCTTTCCCTTCTCGAGGTAGCCGGTCACACAGGTGAAGAACCGCACCACCGATGAGTCCTTGTACCCGACGTCACAAGCTGACGGGA
TGTACACTGTCAGCTTCTTTGTCTCTTCATTGAACTCGTAATTAGTTGTGTCCCGTGGGAAGAGGCCTGCTGGCATATCATATTCTTTGAGAAGATCTGG
TAATGCTTTCTGCAGCTTCCCTTTGATCTTGTTCACCATCCATTTAGCTCCCCCGCCAATACTGGAAGAGACCGAGTTGAGGTCGTCGCCGATGGAGTCG
ATCTCCTTGCTGGCCCTCTTGCTGAACCAGTAGCTCCCCACCTTGTTCAGAACCTGGTCCATCTCCCCCTCCTCTCCTCTTCCCGGCCCCGAATCCGAAC
CCCCAGTCCGCCTCG
page-top