Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29174  (registered. 2012)
Contig Information
Length 1610 bp
Clones alternative view 73 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 11
WH_XE Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|126544454|gb|ABO18602.1|| SGT1-1 [Triticum aestivum]
Score 741
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29174
TTTTTTTTTTGATCAAACAAAAATGAAGTGTGATGCACAGATTTCAGACAAAAAATAGCACCGTTTCACAGATGATAGTTTTGGCACCAGTTACAACGGA
CGTTTTGCACTTCCATACCACAGATGCACAGGTATGGCTTACTCTATTACCAACTGTAGCTCGCAAAACTAGGATAAGTACTTAAAAGCTAACCTGCCAC
GCAAACAGCTTACAAATACGGAAACAGAATCAAGAGCAACACACAATAATCCGACCGACACTGATTTGCAAGTCTGCAGCCAAGTTAACACTCACGACCC
GACCAGGATTTACAACATGGATGATCTGAATTCATTAATACTCCCACTTCTTGAGCTCCATTCCATCAGGAGGGCTTCCTTCAACCGTCTTTTTCCCGAC
ATCCTTCCAGTTGGTTGAGAGAACGGTTCCATTAGACTCCACAAAAGACTTCATCATTGCTCTACGCATATCTTCATCAGCATCACTGTAAATTTCACGG
AAAAATTTGTTCAATGCAGCATCGCCATCAAGTTTTTCATCCTTCTCCTGTTTTTTCACTTCAGCTTCAAGCTTATCCCAGTCCTTTTTGGATTTTGATG
ATGGATAAGATGGCCTCTGGGCTGATTCAGCTGGTACATTTATCTTCTGAGGAGCCTTTGGTTTACCAGTATAATCCAATGATGTCCAAGTTACTGGCTC
AGCTTTTGCAAGGCGCATTTCAACCTTTGTAGACAACACAGTATACTTGCACTTATCTGGGACGATCTTTGAAAACAGACGAGGCTGAAAATGGTATGGT
TCCTCACCGGGAAGTTCAATTGAGACACTCAGCATCTGTTCACCAAAGTCAACAACCACGCTGTCAGCTGGAACACCCTTAGCAAATATAGTCAGTACCA
CTTCTGTAGGAGTATTGTAGTAGTCATGCCTGTATTTGGGCTTGCTTGGCACTTCTACCGTTGGCTGTGCATTCTCCATATTTGCACCATCCTGGTCCTC
AACTTCAGTAGCCACAGTTGTAGCCCCGGAAGATGCCCCCGAAGATGTAGCTGGAGCAACAGCTGCAGCGGCATTCTTTACTGGCACCTGGCTAGCCTCC
TCAGCAATACGATCATCACACTCCTTCATCAGACGAGTAAACCTCGAGTCACCAGATGCATATGAAGAACCCACTTCAAGAGCAGCCTTTGCAGTTTGGT
ATTCCTCCAGCTTGATGCAAGCAGAGCCCTTCCGAAGGTATGCTTTATGCATCGAAGGATCAAGTTCAATTGCTTTGTTGGCATCAGCTACAGCCTCAGT
GTAACTGCCCAGCTTGATGTGCGCCTGGGCTCGGTCGGCGTAGAGTTCCGCGGTGGCCGGCCCCGCCTCAATGGCCTGGGTGTAGAGCTCGGCGGCCAGC
TCGAAGTCGTCGTCGACGAAGGCCTCCTTGGCCTTGCTCTCCAGATCCGACGCGGCGGCGGCGGCCATGTCTGCGTCGAGGTGGAGAAGACCAGACGAAG
ACTTTGGGAGAGGTGAATAGAGATCGACGGTATTTGGTGGGGAGGGGATGGATGGATCCAAGCAAGGGACTGATTGGATTGGATTGAGCAGCGTGCGGTT
AAACGGCCTC
page-top