Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2917  (registered. 2012)
Contig Information
Length 1084 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_SP 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242056959|ref|XP_002457625.1|| hypothetical protein SORBIDRAFT_03g010620 [Sorghum bicolor]
Score 452
Evalue 2.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2917
AGGAATATTGTTTACATCTAAGATTGCCTCTTGGGCATATATATGTTTCTAACAACACTATATGCTGTTGTACTACAAATAATAATAATAACATGTGGCG
TGAAGCACAAAACTATGCTCAAGGGGAAGAATGTCACAAGACAGAACAATAGTTCCTTGTTCTTTTCCAGGTCGCAACAATATTTCTACATCAATGCTTC
ATGCTGCCCCTAGCAAAGTGTGGTCCGAAGGTGCACATAAGACCGACGACGGTGGCCGCGTTAAGCATGAAAAATACAAGGTGGTCGCCTGGAAGAAATG
AAGCAGTTTGGCGCCTTTGAGCCCATGAAAATATAACACCGGCAACAGCCGGAGCGACAGCTTTGAAGATGGACATTAGTGTTACAGAAAGTCCATTGGC
CGATGCTCTTAGGTCTTGACTCACAGCATCATTCATCAAAATATTGCACACCGTGATGGTAGTTACTTGGAAGGAATTCTTCAGAGAAGATGCACAATTT
ACTACCAACTGAAGATTGAACCCTGATAATGTAGTCATGAATGGATAGCTTGCAAGAAGTGGTAATGTCAAGATCGCAGTTGCACGGACTAATGTGATAG
GTTCTATAGCTTTTGCAACCGATGGATAAATCAAAATCTGGTATATTAGGAGGAAGAGACCTGAGAGTGCTAGGACACTGCCCACATCTGTAGAAGTAAA
GTTTAATCCACCATATTTCCTGTCACTAACAGCCCAAAGAGAGAATACCTCTGCATAAGCCACATCCTGAAGAGAGAAAAGGCAATATACGGTGATAGCG
GACATCAATGGCCAGTTTGTGAACAAACTCCAATATCCACCACTGCTTTCTTCAGCATTAGAGTCAGAAAGAGATTCCTCCATGGCTTCAATTGAATTAT
TTGAATCTGTGGCTTCATTGTGTTTATGCAAAGTTTCCGGAAGCCATATGCAAGAAATTAAAGCAGCAACGGCGAGGATTGATATACACAGGCATGGGAG
AAAATATGGAAACCTCCCGAATATAGATTCCTGAGAGAACATACCTGGATATTTATCTGCTGGCTGTGCAAGATAACCACCAAT
page-top