Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29060  (registered. 2012)
Contig Information
Length 1538 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_r Root 4
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 9
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|56606827|gb|AAW02798.1|| calreticulin-like protein [Triticum aestivum]
Score 867
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29060
TTTTTTTTTTGGTACCAAAGGATGAAGACTAGTGCAAGATTTTTTATTTTTTGCTCGTTTAACGACTATAAAGTTCCCTTCCGGTAAAAATTGGACTACA
AAAGCGCTACAAAGACCCCACGGTGATGTTGTTCTTCTACACACAGTAACTTGTCAAGTTTCTGATCACAAAAAGGGGAACATCATAATGAGAGACAACT
AATAAATCATGGCACCGGCGCGAAGGCAGGCGGCCTCCTCTCATCCTCACCATCCATCTAGAGCTCATCGTGCTTCTCGTCATCAGACTCGACATCAGAC
CCAGCCTTGTCATCCTTGTCCTCATCATCGGCATCCTCATCATCCAAGTCATCATCGTCCTCACCAGCCTTGGAAGCATCCTCCTCTTCCTTCTTCTTTT
CAGCCGCGTCAAAAGCAGCCTTCTCAGCCTCCTTATGCTTGGCCCAGGTCTCTTCAGCAAATGTCTTGGCCAAGGCAGCATCGTCAGTGATGAGAATGTT
GTCAAACAAAGTTCCTGACTTAACCTGCCACAGCTCAATTCCGATGTACTTCAGGCTGTCGAAAGCATAGATGTAAGGATCATCCTTGAAGTCTGGGTTG
GCAATCATAGGTGCCTTCCATTTGCCCTGGTAGTTAGGGTTCTTGATTTTCTTTTGCTTCCATGGGCCCTTGTACTCTGGGTTGGGGATGGTTGGGGCAG
TCCATTCACCATCTTCCTCATCATCCCAATCTTCAGGCTTCTTAGCATCAGGATCGGTGACTTCCTTGGGAATGTCATCGTAGCCCTCTGGCTTGACGTC
CTCGGGATCAGGAATGTACTCCTTGTCATCCCAGTCCTCTGGCTTCTTAGCTTCTGGGTCCTTGATTTCCTTGGGAGGAAGAATATCCCAGTGCTCGTAG
ATGCTTCCAGTTTGCTTCTCTTCATTGTCAATGAGAATGCTGTATGTGGCATCAGGGCGGATGATCAAAGTGTACACATGCGACAGCTGATCGGTCTCGC
AAGGCACGTCCTTCTTGATCAAATGGTTCTTGCCATCCTTAGTAAGGATAGTGTGAACCTTCTTGGTGCTGTACCCACAGATATCTGGTCCAAACATAAT
GCTGTATGGTGTGTCGCCACCGAATTTCTTCTGGTCAACATCACCTCCAAGCAACTTGACATAACCACCACCGCAGTCAAGCTTCTGCTCATGCTTCACC
GTGAACTGCAGCACAAGTGTCTTGTCCTTGTTGCTGAACTCAGGGTACTCCGCCGAGATGGCGTAGAACCTGTAGTCCTCTGAGGTTTGGATACCTTTGT
CCTCAGCATCTCCATGCCATTTTCCAGATGTGTGGTTCCATTCACCAGCCATGTTCTCATCCTTCTTCCACTCAGACTTGACCCACCGGCTTTCCCAACC
ATCTTCGAACTTCTCCTGGAAGAAGACGTCGGCGGAGACCGCGGCGACGGAGGCGAGCGCGAGCAGGGCGAGGGCGGCGCAGGAGGGCCCACGGCGGATC
GCCATCTCGGGCGGCGGCGGCAGTCGAGACGAGAGCTC
page-top