Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29049  (registered. 2012)
Contig Information
Length 688 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 15
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242078441|ref|XP_002443989.1|| hypothetical protein SORBIDRAFT_07g005440 [Sorghum bicolor]
Score 226
Evalue 1.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29049
CACTCTTCCACCGACAGCTGCCCTCCCGTCCCGTCTCCCCGCCGCCTCCTCCTCCTCCTCCGCGTCGCAAACCCTCGTCCTAATCCGCCGAATCCCGCGA
CCCACGAACCAAGGCAGATCGATGGCGAAGAGCTCGTTCAAGCTGGAGCACCCGCTCGAGAGGAGGCAGGCGGAGGCTAACCGCATAAGGGAGAAGTACT
CTGACAGAATTCCTGTGATCGTTGAGAAGGCTGGGAAGAGTGATATTCCTGACATTGACAAGAAAAAGTACCTCGTCCCCGCGGACCTTACAGTTGGACA
GTTCGTGTACGTTGTCCGGAAGCGGATCAAGCTCAGTGCTGAGAAGGCGATATTCATCTTTGTGAAGAACACTCTTCCACCGACAGCTGCCCTGATGTCT
GCCATTTACGAGGAGAACAAGGACGAGGACGGCTTCCTCTACATGACCTACAGCGGCGAGAACACCTTCGGATTGCTCTAGATGGCGCTGGCTGCCACGG
CAATCGCTCTGAATGCCTCCTGTAAATAAGGCGTGCCAATCAACTGTGTATATATTCCGGTTTGCCTCGTCGTAGGATCTTTAAATTGCACAACCAAGAA
AAACCTATTCGTATCCTGACTTATCCTATTTGAATGTTCTGACTTATATATATATCAAGTAAGACTCTGAAATTCCGTAAAAAAAAAA
page-top