Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2903  (registered. 2012)
Contig Information
Length 1817 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|16755057|gb|AAL26702.1|| 68 kDa protein HP68 [Triticum aestivum]
Score 833
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2903
GTTTTTTGGTTGGTCTGCCCACCGGCGCGCGTACGACAACACTTCCATAGCCAAAGCCAAAGTGATATACCCTTCTCCCCGCCGCCACTTCCACGCCTAA
CTCTAGTGCCGCCGCCTGTGGTAGCGCTCTGCCCCCTCCAGCGGAAATCTCTTTGGACGGGGCGGCGAATACGGAGAGTCGCCGCAGATGGCGGACCGTT
TGACCCGTATCGCGATCGTGAGCGAGGATAAGTGCAAGCCCAAGAAGTGCCGCCAGGAGTGCAAGAAGAGCTGCCCCGTTGTCAAGACCGGAAAGCTTTG
CATTGAAGTTAGTCCAGTGGCCAAACTTGCATTCATTTCTGAAGAGCTGTGTATTGGTTGTGGTATTTGTGTTAAGAAATGCCCTTTTGATGCCATTGAA
ATCATCAATCTTCCAAAAGATTTGGAGAAAGATACTACCCATCGCTATGGACCGAATACCTTCAAATTGCACAGGTTGCCTGTTCCAAGACCTGGTCAAG
TTTTGGGTCTTGTTGGAACCAATGGAATTGGGAAGTCAACAGCACTTAAAGTCTTAGCTGGCAAGCTGAAGCCCAATCTGGGACGATTCAAAAATCCACC
TGACTGGCAAGAGATCCTTACATATTTCCGTGGGTCTGAACTTCAGAACTATTTTACGCGCATATTGGAGGATAACCTGAAGGCAATCATCAAGCCACAG
TATGTCGACCATATTCCAAAAGCTGTTCAAGGAAATGTAGGGCAAGTACTTGAGCAGAAAGATGAGCGGGATATGAAAAATGAGCTGTGCGTTGACCTTG
AATTGAACCAAGTTATTGACAGAAATGTAGGAGATCTGTCTGGTGGCGAGCTTCAGAGATTTGCAATAGCAGTTGTTGCTGTACAAAGTGCGGAAATTTA
CATGTTTGATGAGCCATCAAGTTATTTGGACGTTAAACAGAGGCTTAAGGCTGCCCGAGTCATTAGGTCTTTGCTTAGATCAAACAGCTATGTCATTGTT
GTCGAACATGACTTGAGTGTCTTAGATTACTTGTCCGACTTTATTTGCTGCTTATATGGGAAGCCAGGTGCTTACGGTGTAGTTACGTTACCATTTTCTG
TCCGAGAAGGTATCAATATTTTCCTGGCTGGATTTGTTCCAACAGAAAACCTTCGGTTTCGAGATGAATCTCTTACATTTAAGATTGCGGAGACCCAGGA
AAGCGCAGAGGAAGTTGCTACGTACCAGCGGTACAAGTACCCTACCATGAGCAAAACACAGGGAAATTTCAAGCTCTCTGTTGTTGAGGGTGAATTCACT
GATTCTCAGATTGTTGTGATGCTTGGTGAGAACGGCACAGGGAAAACTACATTCATCAGAATGCTGGCCGGGTTGTTGAAGCCAGATACCATGGAAGGAA
CCGAGGTTGAAATTCCTGAATTCAATGTGTCCTACTACTACCTAGATGACTAGTGAGAGGGGGCACACAGGTTGCTACAATTTGGTATTGGTTAATGGCT
GCACGTATCTTATTCTTGATTGTTTAGTGAATTTGTTTCTTTTTGGGCTCCTGTGTAGATTCTTGTTGGACGTCAATAATGTTTTGAACCCTTCCGGATC
ATGCGCGAGGCTAACGAGAACTTGCCATGACGTGTGTCCATGAGACATGTGAATTGGCCACAGGAGTGAAGTGCATCGAGTGTGGTGCTTGGGTTTCAAA
GAAGTGCATGTGTTGAAACTGTATTTTTTGTTGGTTTGAGCTGTGGGGAGAACGATTATCAGTTTTCTTGTATTTGCATTGCTGTATCATGGCTTTACCA
TCTCATATTGTTTTATC
page-top