Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig29018  (registered. 2012)
Contig Information
Length 1031 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196329|gb|EEC78756.1|| hypothetical protein OsI_18978 [Oryza sativa Indica Group]
Score 226
Evalue 6.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig29018
AAGCGGAGGGGGATCTTCGTCCTGATGGGACACTCGTGATAAATGGACGCCCAGTTGCAATAGTTTACTTCAGGGCAGGGTACTCACCGGCTGATTACCC
ATCAGAAGCCGAATGGAGAGCAAGACTCTTGATCGAGCGTTCTTCTGCTATTAAGTGCCCGTCAATAGCACACCATCTTGTCGGTACAAAGAAGATTCAA
CAAGAACTGGCGAAGGAAAATGTGCTTGAAAGGTTTCTTGACAACCAATCCGACATAGAAAATGTACGAAAATGCTTCGCAGGATTGTGGAGTTTGGAGA
ATGACATTATAGTAAATTCCGCTATTGAATCGCCGGAGTTGTTTGTTCTCAAACCACAGAGGGAGGGTGGAGGTATTACCTCAGTCTCACCATGCAGCCA
AAATGTTGGACACTATTGACCGATGAGTAACCCTGATATTCCGTTCAGGGAACAACATTTACGGGGATAATCTACGTGAAACATTGATTCGCCTTCGGAA
GGATGGAAGCAATGAAACTGCAGCATACATCTTAATGCAAAGGATATTCCCACCAGCATCTCCCAGCTATCTTGTCCGCGAGGGAACTTTTGTTAGGGAT
AATGTTGTTTCTGAGTTTGGAATATTTGGAGCCTACCTTAGGAACAACGACAAGGTCATTATAAATGATCAGTGCGGTTATTTGTTGAGGACCAAAGCAG
CTTCACTAAATGAAGGTGGGGTGGTTGCTGGATATGCGTTTTTGAATAGCATATTTCTGACATGACAAGGTTATCCACAGAGCTACGCACCGAATCTGTA
TGTAGTCCTTACATCAGCATGTGGAAGCTCGGGGCTTCTAGACTTTGGATACAAGCATTTGGAGATGACCGTACATGCTTTATTCAACAAGTTTATATGG
TAGCATAGAAATAGGTTTAGTAATGCATGAGTGTCTTATGTACAAATGTATTGTCCGTGGTTGTGTCCTTTTTATCTATTTATGTAATGTCCTGAAAATT
GTATAATAAATGGCTGTGTGCAAAAAAAAAA
page-top