Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2899  (registered. 2012)
Contig Information
Length 498 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68655500|emb|CAJ01714.1|| methionine synthase 2 enzyme [Hordeum vulgare subsp. vulgare]
Score 315
Evalue 1.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2899
GGGTCTGCCGCTGCGCAAGTCGGAGCATGCTTTCTACTTGGACTGGGCTGTCCACTCATTCAGAATCACCAACTGCGGTGTGCAAGACACCACTCAGATC
CACACCCACATGTGCTACTCCAACTTCAACGATATCATCCACTCCATCATCAACATGGACGCCGACGTCATCACCATCGAGAACTCCCGCTCCGACGAGA
AGCTCCTGTCGGTCTTCCGCGAGGGCGTGACCTACGGAGCCGGCATCGGCCCTGGCGTCTACGACATCCACTCCCCCAGGATCCCCTCCACGGAGGAGAT
TGCCGACCGCGTCAACAAGATGCTCGCGGTGCTCGACACCAACATCCTGTGGGTGAACCCCGACTGCGGCCTCAAGACCCGCAAGTACACGGAGGTGAAG
CCCGCCCTGACCAACATGGTCGCCGCGGCCAAGCTCATCCGCACCCAGCTCGCCAGCACAAAGTGAAGAGCCTGATGCTACTACCTATTGTTTTGTTT
page-top