Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28883  (registered. 2012)
Contig Information
Length 1589 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VHS Shoot with heat shock treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1915960|emb|CAA68913.1|| peptidylprolyl isomerase [Triticum aestivum]
Score 813
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28883
ATTTCGTTTAAACGAAATAGACACTCTTTTTACTAGAATCGTACGTCAGCAAATTATGAGTACATTATCAAGGCACGCAGCCGATCACAGACGAGGCACA
AGCTGCAGAACAGAGGACAAGACAACCAAAACCACGGTACAACGCTGATACAAACTCCAGACCCGGCTGTACCAGGACGCGGCAGACCCGTCACGCGGTG
CTGTCGATGGCCATAGGCTGCGCGTTCTGCTTCCCGGCGGCGTTCTCCGTCTTCCTCCATTTGGCGAACATGTTGCCGTAGAACTTGGCGTCCCTCTTGT
TGTACTCCCTCAGCTTGTCCTTCAACGCCTTGTACGCAACCTTCACCTCCCTGTTGTCTGGGTCGATCTCCAGAGCCTTCTTGATATCTAGTTCTGCCAG
CTCCAGATCCACGAGCTCGGTGTACGCCTGCGCCCTCCGGTACAGAGCCTTGACGTTTGTGCTCTCCAGCTCCAAAACCTTGGCGCAGAGTTTCTCTGCT
TCCTTGTAATCCTTGAGTTTCAGTTTGCACGCTGCGTTGTTGAGCTTGATGCTGATCTTCACTGCCTTGGATTGCTTCTTCTCGTCCTCGCTGAAGGAGC
TGTCATACTCAATGTACTTTGCAGCCTTCTCATATCTCTTGGAAGCCTTGGCGTACTTGCCCATCTTAAACCACGCATTTCCTTCATCTTTCTTTTTAGC
AGCTGCTTCGATGTTCTCAGCATTACTCTTCAAGTCCCAAGATTCTTTCTCCTTCTCGAAGGAAACGAGGTCCACTTCATAAAAGACGGTGGAGTTGGGA
GGAACCATAGCAATATCAAGCTTCGTCTCAGTGGAACCGAACGCATGTTCAGGTGGTATTCTAGCTGACGCGACCTCTCCTTTCTTCATGGTGAGCACCG
TCGTGTCCAGCCCTTCGATGACCTGCTCCTCATCCGTCTTGAACTCGAATGGTTCGTCGCCTTCATGTCCTTTCTTCGTGAACACAGTGCCGTCGTCCAA
CTTGCCGATCAGTCTCACTCTGACAACTGCCCCGTCGTTGGGGCGCTCGTAGCCTTCTCCTTCCTTGAGCACCTTCTTCATGGTCTTCACGGCTTTGGAA
AGTGCAGGGCAGAAGTAACCATCCTTCACTGCGAATTCAATACCCTCTGACTTGGACACGACGGATCCATCCTCAAGTCTCGCCTCGTACTTGACAGTAA
CTTCGTCGAGATCCTTGGGATTCTCCCATTTCTGACCCTCGACCAGGACCTTCTTGAAGATGCCGCCGTCCTTGCAGATGTCCTTGACGCTGGCCCACGA
GAGGAGCTCGACGTCGAACTGGAGCGTGGCGTTGGGCGGGATCGTGGGCGGGGAGCCCGCCTCGCCGTACGCGAGGTCCGGCGGGATGGTGAGGACGGCG
TTCTCGCCCTTCTTCATGGTCTTGATGCCCTGGTCCCATCCCTTGATCACCTGCCCCTGCCCGAGCTTGAACTTGAAGGGAGTCCCGCGGTCTCGGCTCG
AATCGAACTTGGTCCCGTCGAGGAGAGTGCCCGTGTAGTGCACTTCGACCTCGTCGCCGGTCTCGGGCCGTTCCCAGCCCTCGCCCTCC
page-top