Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28815  (registered. 2012)
Contig Information
Length 688 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_VWD Shoot grown with dessication 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_F/WH_R 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242044716|ref|XP_002460229.1|| hypothetical protein SORBIDRAFT_02g025020 [Sorghum bicolor]
Score 274
Evalue 5.00E-72
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28815
CACAAGTAATTATACATGTTTTTCTTAGCTACATTAGGCTTTGATTTGAGCAAAACTTACCAGCTACCCACAAGAGCAATCACAGCTAGAACACATGAAT
GCTGTTCATTCTTGCTTGACATCCAAATTCTGGTCCTCTGTTCAATTCTTGTTTAAACCATTTCTGGCCACCAAAATATTACACAAAACATAGCATGAAC
AAAAACATCCACAATACAAAACTTGCGTCCAAATTGTTCTTCTCCCTATGCACAATCTTCAGAACTCCTGATGCCTCAGCAATTGATGCCGCACTGCTTC
ACATCAGGCCCCTTGGCCTTGACGGTGAAGGGGTCGATCCTGACCCAGAGCAGGGAGAAGATGGAGGCCAGCAGCACGGACCAGATGATGACGATGGTGG
GCGTCCTGTTCTGCCTCCCCATGAGACCCTTGAGGAACGGGTAGAGATGCACGATCACCCAGAAGGCGAAGAAGAGCTTGCCGAAGAGCGGGCCCCACGA
CTGGTACCCGTTGTTGATGGCGTCGGAGATGCCCGCCACCACGCCGATGATGTTGATGACGAGCAGCGTCGTCGGCGGGATGAGGAGGGTGGTCCACTTG
AAGGCGTAGAGCTCCGCAAACTCGTCGTCCTCGTCTCCCGTGGCCTTGGAGGTGACGGTGAAGTTGGTGTCGATCCCGGCCAGGACCT
page-top