Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28766  (registered. 2012)
Contig Information
Length 2155 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_SHDr Shoot grown with dessication 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462585|ref|NP_001054892.1|| Os05g0204900 [Oryza sativa (japonica cultivar-group)]
Score 869
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28766
CGCCGCCGTAGCTTAGCGCGCGTCGCCGCCTCACGTCTCTCGCCTCTCGAACGCGTCGCGGCCGCCGCCGCCGCTCCCGTTCTGCCCCGTCGCGCGCCGC
TGCCCTGCCCTGCCCCAGCCGTTTACACCCCGTCCGCAACCTTGGACGGCGGCTTTCGAGGTGAATAAGGAGCTTTGAAGTCTGTGTATGAACTAGACAC
AACAGATATCATGGGTGATAGTTCAAATTCAAATGTGCAGAAGGCTGAGGAACTCAAACTTAGGGCAAACGATGCCTTCAAGGCAAACAAGTTTTCTCAG
GCTGTAGAGCTCTATGACCAGGCTATTGATCTAAATGGTTCAAATGCGGTTTATTGGGCAAATCGTGCATTTGCACATACAAAGCTTGAGGAATATGGAA
GTGCTGTCCAGGATGCTACAAAGGCTATTGAGATTGATCCTAAATATTCGAAAGGTTATTATAGACGAGGTGCGGCATATCTTGCTATGGGAAAATTCAA
GGAAGCCCTGAAAGATTTTCAACAGGTGAAAAGAATCTGTCCTAATGATCCAGATGCTACAAGAAAGTTGAAAGAGTGTGAGAAAGCTGTCCAAAAAATC
CGCTTCGAAGAAGCAATTTCTGTAGGGGATACAGAAAGGCGCTCAATAGCAGATTCTCTTGATTATCATATAATAGAAGTTGAACCACAGTATACTGGAG
CAAGAATTGATGGGGATACAATAACATTAGATTTTGTCAAGCAGATGCTGGAGGATTTCAAGAAGCAAAGATGTATACATAAAAGGTATGCATTACAGAT
TGTGTTGCAAGCACGGGACTTGCTGCGAGCAGTGCCTTCCCTTGTCGATGTGAATGTTCCGAATGGTTGTCACTTTACGGTCTGCGGTGATGTTCATGGC
CAGTACTTCGATCTGCTAAATATATTTGAGCTCAATGGACTTCCCTCTGAAGACAACCCTTACCTCTTCAATGGAGACTTTGTGGACAGAGGATCGTTTT
CACTTGAAGTCATACTTACTCTCTTTGCATTCAAGTGCCTCTATCCAACTGGTATGTATCTAGCAAGAGGAAACCATGAAAGCAAGAGCATGAACAAAAT
ATACGGTTTTGAGGGAGAAGTGAAGTCCAAGTTGAGTGATACGTTTGTCGAGCTGTTTGCTGAAGTATTTTGTTGCTTACCTCTGGCTCATGTAATCAAC
AAGAAGGTCTTTGTAGTTCATGGGGGTCTGTTTAGTGTTGATGGAGTAAAGTTATCGGACATTAAGGCCATTGATCGTTTCTGTGAGCCTCCTGAAGAAG
GTTTGATGTGTGAAATTCTATGGAGTGACCCTCAGCCTCAGCCTGGGAGAGGTCCAAGCAAACGAGGTGTAGGGCTTTCCTTTGGTGGAGATGTGACAAA
GAGGTTTTTAGAAGATAACAACCTTGACCTTGTTGTCCGATCCCACGAAGTTAAGGATGAAGGGTATGAAACCATGCATGACGGAAAGCTTATTACTGTC
TTCTCAGCTCCTAACTATTGCGACCAGATGGGCAACAAAGGTGCATTTATTCGGTTCAGTGCTCCAGATTTAAAGCCAGATATTGTTAGTTTCTCAGCAG
TGTCACACCCTGATGTCAAGCCGATGGCCTACGCAAACAATTTCCTCCGGATGTTCCAATAGCACCAGGCGGGACCTGTCTGGCCAATTTTGATATGCAA
AACTTTTCTGTGCCCAGCTCACTGCGTACCAAGTTCTCATCCAAGTCTTGCGTTGAGCAGCAAATATTTTGCTACAACAACTTTAGATGCTGCTGTTACC
CCTCCTGCCCTTTGTTAAATTATTATTGGTTCTAGCACAGTGATTTAGGTGTCTGTAGTTGTACATTTGCTTTATCTTCCTGCCCTTGTCCCTGTGATTC
CCTTCATATCTCTAGTACATCAGTCTCTGCTCAGCTTTCACCGTGCTGACACCCCAGGATTGATGCCTTTTTGCTCTCTATTACTTGTGTGGATTGTTGT
ACTACATTTCATACACAAAATGATTCCCTATGATTATTTTGTACTGAGGGCGAGCACAGGATTGTGCAATATAGTGTTGTGTCAACGCCACAATGCGGCC
TTGTAACACTATTGTTTAGTTTGCCTGCCACTTCTATGTTACTTTAAAAAAAAAA
page-top