Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28712  (registered. 2012)
Contig Information
Length 1202 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XN Leaves, plant was grown at constant 23Ž 3
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226493880|ref|NP_001147677.1|| LOC100281287 [Zea mays]
Score 493
Evalue 1.00E-137
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28712
TTTTTTTTTTGAGGGGTATGCGTGTAAGTCCTTATTTCCCATGAATTTGGGTATCTTCTGTTCAAACAACAAATCAGATAAACATAACCAATCGTGCCGA
TCATACACCAGAGCAACAGACGGCAGTTCCTATCCGTAGATGTCGCCTGTCTATTCTCAGTTCATTGTGAGCCAGAACCAAGGTTTGATAAAAGAATCAA
AGACATCCATGCGCCCGGCAGTTTCAGTTCTTGCTAGCTTCTTCAGCCTCCTTCTCGTCTGCGACATCGCTGGGCATATCAAGCCCGGTCGGTATCTTCC
CAGCGAAGTTGTATTTAGAGGCATCCGATCCAAGGTTACTTCTGTCGACCAAGACCATTGACCGGAGCTCACAGTTGGCGAAGTGCTTGCCCAGCTCCTC
TGCTATGGTTGGATGACACTCTTTACCGTACATGTTTAGGGTGTGATACAAGAAACCGCTATGGCTGACAATAGCAATCTCTTTCTCTTCTCTTGTCCAT
AACCAGTCAAAGAACTTCATGCCCCTGAGAGCAACAGACTCATTTGTTTCTCTGACATCGGGTTCCCAGAGAACATCTTCATCATTCTCTATCAAGGAAA
AATCAATGGCAGGAAAGAGTGTACGGTATTTTGTTATGCTGCTCCTCTTGTCACAGGGATGAACACCCAAGTGCTCCCTGCAGGCCTCAACTGCAAGAAA
CGGTGGGCAGTTCAAACTTGAAATTGGCTGACGTCCACTGTTTCCAGCACCTTCTACCATTAATGGTGATGCACTTGCTCCATCAGTATAGTTCCCACCA
CCAAAGACCCCTACTGCAGTTTGCATAGTCCTCAGTAGAGGGGAAACAATAACCAACTCAATCTTTTTTGCCAGTCCAGATTTTGTCACATGCTCTCGCA
GGGTATCAACTTGGCTCCAGCCCAAAGGGGTAAGTTGAGCATCAAGCAGCGCATGTGACTTGTATGCTGCAAAATCCTTCTCGCCCTCCACGTTGTGAAT
ACCCTGGGCATGCCTCACCAGGTATATGGTTTTGCATCGGTGCGCGGGGTACAGAGCTGTCCCAGCGCCGGCCTCCATTTCTGAGTGGGAGGACGAGGAG
CAGCGGCAGCCGCTGAAGGAAGCGCGGCGGCGACGGCGACGGCGACGGCGGAGGGAAACTCGTCCGACGGCGAAGGAGGGGGGCGACGACGAGGCTGCTG
CG
page-top