Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28638  (registered. 2012)
Contig Information
Length 1939 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_RDr Root of dessiccated seed 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115480057|ref|NP_001063622.1|| Os09g0508300 [Oryza sativa (japonica cultivar-group)]
Score 835
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28638
GCGCCCCGCCGCCGCCGCCGCCTCCTCCACACCCGTCCTGCGCGGCGCGGCCGCGTCTTGCTCCGTGCGGCGAGAGGCGAGATCTCGGCCGGGCTTTGCT
GCGCGCGCCGCCGTAGTGGAGGAGGCGGCGGGGGCGGTTGGTGGGCGGGGCCAGGTGGCCTAGCGGTTCGTGGTCGCCGGAGTTACAGCAGGACGAGTGG
GAGTCGTCGTCGTCTCGCGGGTCGCGGCGGCGATGTACGTGCCGCAGTCGTCCCGCGGCGGGGGCGGCTCCGCCGGGGAGCAGCCTAGGGTTTACCAAGT
CTGGCGGGGAAGCAACGAGTTTCTCTTGCAAGGGCGGTTCATATTTGGACCTGATGTGAGATCCTTGTTTCTCACTATATTCCTCATCCTTGCACCAGTG
TTGGTCTTCTGTATATTTGTTGCCAGACATCTGATGAATGATTTTCCTGATCACTGGGGGATTTCAGTTATGGTTGTAGCGGTTGTCTTCACAGTATATG
ATTTGACGCTGCTGCTTCTTACCTCTGGTAGAGATCCTGGTATAGTACCTCGTAACACGCACCCCCCTGAACCTGAATCCCTTGATGGGAACAATGATAC
TGGAAACGGTCAGACTCCACAACAATTGCGCTTACCACGGACAAAGGATGTTTATGTAAATGGAGTTGTTGTAAAGGTCAAGTACTGCGACACCTGCATG
CTGTATCGGCCACCTCGTTGCTCTCACTGTTCTATCTGTAACAACTGTGTGGAGCGTTTTGATCATCACTGTCCTTGGGTTGGTCAATGCATAGGACTGC
GTAATTATCGCTTCTTCTATATGTTTGTCTTCTCGACCACATTACTCTGCCTCTACGTATTTGGGTTCTGCTGGGTGTACATAATTAAGATCAGAGATGC
AGAAGATTCATCGATTTGGAGGGCAATGTTGAAGACACCTGCCTCAATGGTTCTGATCATCTACTGTTTTATTTGTGTGTGGTTTGTTGGTGGTCTTTCT
GTCTTCCATTTCTACCTGATGAGCACCAACCAGACTACTTACGAGAACTTCAGGTATCGGTACGACCGGCGGGCTAACCCATATAATGTAGGTGTGGTGA
ACAACTTTCTGGAGATCTTCTGCACTGCTGTCCCCGCTTCCAAGAATTATTTCCGAGCTAGGGTCCCAGTAGAGCAAGGTTTACAGCAATCACGCCCACC
AACCAGGGGCTTCATGAGCCCAAACATGGGCAAACCTGTTGGAGACCTTGAATTGGGCAGGAAGCCAGTATCATGGGACGAACCTCGGTCAGGAGCTGAT
ATAAGAGATTTAGAAGTTGGGGGCATGTTGGATGAGAAAGAAGGCAGAATAACCCATGCGTCACCTGATCTCAGCAGAGAAGCCCTTCCAGTTGAGCTCA
TGGAAGGTAGGGCTGGTATGCATTCGAGACGATCAAGCTGGGGTCACAGAAGTGGGACCTCAGAGTCGATGGACAGCATTGCCGTGCAGATGGGAGGTGG
AGAAACTAACTGGGGCTCGGTCAGCAGTGGCCACGGCACAACCAGTGGAACTCACTAGCAAACCGAACGCCGCTTTCTGACGCCACACTGGGTCTGATCT
CAACAACGAACGACCCTGTCTGATCTACAGAATGAAGAACGGCCTTTCTGAGTACCCTGCGATCATGTGCCTTTCAATTAGGGTATACTATATGCCAATG
CTTTCTTACCCGTGTCCGTTTCATCTTGGAAGGGCGTCAGTCCTTTTGATGTGCTTCTCGTTTGGTGTTTTAAGTAAGCAAAGAAAATAACAGAAGAGAT
TTAACTCCTGCTGCGTGGCTTGGATTGTCAATCTGTGTGTATATATTTATTATTGGAACAGTCTGTAAGAAAGTGTGCTCTGTATGATTTGCTGCTTGTA
ATATTCTTAGCTTTGAAATCATGTTTTATAAAAAAAAAA
page-top