Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28610  (registered. 2012)
Contig Information
Length 1318 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115454489|ref|NP_001050845.1|| Os03g0666200 [Oryza sativa (japonica cultivar-group)]
Score 621
Evalue 5.00E-176
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28610
GCATAAAGAGGCAGTAAATTCTTTAGCTGGGAATGGCTCTCCTTCTACATTAGGCACGGTTGCTACTGCAGTTGCTAATGCTAATGCAACTGCTTTGGAG
GCAATGAAGGAGATAGATGCAGCACTGAAGGTTTCAATGAGGGCAGCTCTTGGGTTGGGTACAAATAATTCGAATGTGGGTCAACTTGATGATTTAACTA
TCATGAAGGAGACTCTCCGAGTGAAAGATGAGGAGTTGCAGCATTTGGCTAAGGACATTCGTGCTCGTGACGCCACAATTCAGGAAATTGCAGAGAAGTT
AACGGAGACCGCAGAGGCTGCAGAAGCAGCAGCGTCTGCAGCTCATACAATCGATGAACAGAGACGACTTCTATGTTCAGAGATTGAGCGTCTGAAAAAA
GCAATGGAAACACAAATGGAACAATCCATGCTTAAGCTACGACAATCTGAAGAGAAGGTAATTAGCCTGAGCAAAGAGAACGACCAGTTGATGAAGGAAA
GAGATGCCGCATTTCAGGAAGCATATATGTGGCGCACTGAACTAGGAAAAGCTAGAGAGCAAGCAGTGATACAGGAAGCAGCAATTGCTCGAGCAGAGGA
GAAGGTAGGGGTGTCTGAAGCGGATGCCGCGGTTCGGATCAAGGAAGCCGCTGAAAAACTGCATGCTGCTGAGAAAGAAAAGGAGGAACTTTTAGCCCTT
ATTGGTGTTCTCCAATCACAAGTGCAGAGAGAACAAAGCAGCACGAAGCAAGTATGCGAGGAGAGATCCGAGTCATGCTCCGGCGCCGACAACTCCCCTC
CGCTGACGAAGCACGTCGACGCATCGGACGACGACGTGGACAAGGCGTGCGTGAGCGATTCGAGATCGGTCGTGGTCTCGAGCGAGAGCACGGAGGTCCA
GCTGGCCGTGGACGGGGTGGACATCCGCCCCATCGGCGACCCGGAGTGGGGCAGCTTCCAGCAGCCGGAAGCGCTGATCGCCGACGTGCGGGAGGTCTCC
CCGGAGGCGGAAGGCAGCAGCCTGGATATCCCGGTGGTCAACCCGGCACCGGCCAATGATCATATGCAGGGAGGGGCAACACATCCCTGAAGGCCTGGAG
GTCTTCTTGGGTGGTTTGTGATTATTGAGGAGATTTGAATCCTCTCGAGATTTGAATCCTCTCGAGAATTACTTTTGCGTTTTTTTGTGCTGTGCTGCTT
CCGGGTTGTGTCTCCGTTGTATTTAAGTATGCAACTCAATAAAAAGATGATAGCGGGTTGTCGTGTGATTGTAAATTATTATTATTCACGTCATATCTCT
TTTGTGCCAAAAAAAAAA
page-top