Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28585  (registered. 2012)
Contig Information
Length 867 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 4
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22093725|dbj|BAC07018.1|| unknown protein [Oryza sativa Japonica Group]
Score 323
Evalue 2.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28585
CGTGGCATGCATATGCTACTGTACTGTGGTGTCAACTGGACCAAGTAGAAATGAAAATCTGAATGATACAGAAACGATTGACACGGGTATAAGATCAACA
CGCTCATTTGCAGCGGTGTAGCACGCGATATGAGCAACACAACATCGATCTTCTCACTTCATCAGCAAAACTACGAACCCTACCAGCGAAACAATCATCC
AGCTGAACGGCTGGACCGAAGGAGCCCAGTTGGAGCCTGGGGGAGCAGGGGAGTAGTCGCCGGAGTCGGTGCTGGTGCTGAGGACGACGACCACCCAGTC
GCCTTCGTTGGCGATCCCGACGCCGGAGTACTTGGTGTCGTTGAGGAACCGGTTGTACTGGGACTTGGTGTAGTTGGTCAGCACAATGTCGGCCACAAGG
CCGGGCACGCATGCCGGCATCACCTGCCCGTCCTCGGTCACCGACGCGTTGAGGTGGCATCGGTCGAGGAACTGGGGGTAGTCGGGGAACTGCGGCTCGG
TGCCGGGCACGGTGTTGGCTCCGGTGGTGTTGGTGCACTCCTGGCCCTTGAACTTCTTCGCTAGCTGCTCGGCCAGGCAGTCGGCATTGCTGTTCTCGGT
GAGCGCCGGGACCTTGAGCGAAGCTCTGTAGCTGTTGATCCCCTTGAGGAGCTGGTTGTCCTCCCCGTCAGATCTGGCGGGGTGCAGGAGGGAGGAGGCG
ACGGCCAGGAAGCAGAAGAGCGCGGCCCTGGAACTGGAATCCATTTGCCCCGACAATCCACCGAGCTCCACCACTGCGCGCACCCTCCGACCGACGGGTA
GGGTAGCAGGTATATAGGGGGGAGTGAGGAGGAAGGAAGGAGGCGAGCTGCTGTCTGCGGCCAACCA
page-top