Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28562  (registered. 2012)
Contig Information
Length 2083 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|75261364|sp|Q6K669.1|AMPL2_ORYSJ|AMPL2_ORYSJ RecName: Full=Leucine aminopeptidase 2, chloroplastic; AltName:"
Score 1017
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28562
TTTTTTTTTTGAAAACGATGAAACACCATTTAATCTGACAAGGGAAGTGTTCAACGACATTCTGATTCTGTTTTATTTTCCTCCATGAAACCCTTCCTTA
TTCTATCGCTCCCCTCCATAGTCCATACGCCAGCCAAAAGCAAATAAAATCCATTCATTTTCCCTGGTACAATCATGAATGAACAGCACTCTGTTTTTCT
TCCTTCTCTGGCGTTGTTATCAGAACCAATGGAAATCAGGGGGGATGTCCATTCAGGATGATGAGTTCTTGAGCACCCACTCCACCAGGGTGGACACGCC
GAATCCGGTGGCGGCACGCTTCTTGTCGTTCCACACCGGCCCCGCCATGTCGATGTGCATCCACTGAACCTTCTCGTCGACAAACTGTTTAAGGAACAGG
GCAGCGGTGATGGAGCCTCCCTGTCGACCACCGGTGTTGACCATGTCGGCCACACCAGACTTCATCTGCTCCCAGTAGCTTTCCTCCATGGGCAATCTCC
AGAACTTCTCCCCCGATAACTCAGATGCAGCGGCGACTTCCTGGGCTAGTTCATCACTTGGTGTGAAGATTCCAGCAATGCTAGGCCCAAGTGCAACAAC
GCAGGCACCAGTTAGTGTTGCCAGATCAATAATCTTGTCAACACCTTGATTACAAGCATAGACCAAAGCATCAGCAAGTGTAAGCCTCCCTTCAGCGTCA
GTGTTATTTACCTCAATTGTCATCCCGTTAGAAGCAGTCAAAATGTCACCAGGTCTCATTCCTGTGCCACTAATCATATTCTCACAGGCGGCAACAATAA
AGTGAACCTCTACTCCAGGAGGTTTGATTTGGGCCAAAGCTTTTGCTGCACCAAATACTGCTGCGGAGCCTCCCATGTCAAACTTCATCAGTTCAATACT
GCAACCTGGTCCAGTCTTAATGTTGTAGCCTCCACTGTCAAAAGTTAGACCCTTCCCAACAATAGCCAGCTTTCTCTTGACATTGCCACCAACGGGTTTG
TAGCACAAGTGGATGAAGTGAGGAGGATTTGCAGAAGCTGCGGCAACTCCCAAGTAGGAGCCCATCTTTAGCTCCTGGCATTTCTCTACATCTAATATTG
TGGCAGTGAATACATCACTGTGTTCAGAAGCAATCTTTGATGCCTCCTCCGCAAGCACAGCAGGGGTAAGGACATTTGCAGGTGCGTTGACAAGCTCTTT
CCCGAAAATCACGCCCGAGGAAAGATCATTCACATACTTAAGCTTCTGGTCCAGCTCTGAACCAGAACCCAGTCCAATAAGATCTACTTGTTTAAGATGC
ACCTTCTTTGACTCAGCCTTGAATCTGCTGTCCTCATGCAAGCCAAGCACGGTTCCAGAAGCGATTGCCGCTGCAGCGTTGAGCTTGAACCCTTCCTGGA
CCCCAGTAGGGGAGGCAAGGACAACAGCAACGCTGCTAGCCTGAGCAGACTTGGCAACCGATGCAACAGATTCACCAATACCCCGGCAAGCCGCGGCGGT
GGATGGGGTGCTCTGGCCGAGGCCAACCAGGGCCACCCTCTTGAAGCCCTGCCCGGAGAGGCGGAGAACCACCGACTGCCCGGCCTTCCCGGTGAAATCC
TCCTCGGCTGAGGCCTCAGAGAGCAGACCGCTGAGCTGAGCGTCGAGCTTCTTTAGCACAGCATTCTCGAATTTGGAGTCTGATCCTTTGGACAGATCCT
TCTCCGTGACCGCGACGGCGAGGATGTCGCCCTTCCAGTCGGAGAATTCGATGTCCTTACCAGTGAAAGCAATCTGGGGGAGCTCGACGGCGTTGGCCTT
GGTGAGCCCGAGCGCGGGGACGGCGGACGCCGCGGCGGAGGTGTGGCCCATCCTGGCGCGGTGCCCGAGCGGGCGGCGGAGAGCGGCGGCGGCGCCGAAC
GACGACGACGACGACGGATGAGACGACGAGGCCGCGGGGCGCGCGCGGGGGAGGCGGCGCAGCAGGTGCGGCGCGCGGCGCAGGAGCAGGCGGGAGGCGA
CGGCGACGGCGGCGGAGGCGGAGGTGGATGCGGCGGACGCCATTGGAGTGGGGCGCGGGGCGAGGTATATATCGGGCGCGGTC
page-top