Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2853  (registered. 2012)
Contig Information
Length 1076 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig2853
ACCACAGTACTATTCTCACCAGCATCGTTCAATTTTAAAAAGTAAAAAAAAACATCAAACATGGGAAGCTTACCGCCCATCCGAAAAATCATCATACTCA
TGGCTATCATACATCATATAACTTTTTTTTACTGAGAAGCCACTATTGAGAAGCCATGTGACAATTAACCACTGCATTGTATTTCCCATCACACAATGGA
CATACATAACTATCCCATATAAACCCAATCACTACTTTCTCCAGTGGCTATTGCCGACAAAATTGGAGCTTCTCATGTACACCGGACAAGAAGGAACAAG
CAGCCGCACAGCCACCGCACGGCAAAGCAGACGAAGAAGCCCCTCCCTAACCAAACGCAACAGCAGCAGCGCGAGTATCCTTATCTCCAATAGTATTTTG
GCCTGTGTAGGAGACAAGTGTGCGTTTACATCCAGGAATTTAAGCATCTGCCCAGAGCAATCCCGACCCTCTTCTTAACAACCCCAGGCTGCTGAAAGAA
ACCTGTTGCAGTCCTTACATCCATCAAAGAGGATCCTACTAATTCCTATGATGGGTTGTGCATGAGCAAAAATCAACATTAACCAACTTGGAACTTTCAA
AGATCTGCCCCAGAGTAGGCAATGGACATGATTATGCCACATGCTGCAAGGCCGACAATGACGCCACCATCGCTGCTGCTGATGAGCGAGGGAGAATATA
AAGAGGGCAATATTGCCATAGGTGGGCGCAAGGTTAAAGTTCTCCTTATCTGAGAGAGAGAGAGCGCGCACACACGGAGCAGCCGCAGCTCGGCGTCGAG
GAGGCACAGAGACGGCCGGCCCCCCACCTCCCTTCCTCCTCTCCCGATCCAGGAGCGGATCGAGCCGCCAAACATTGAATACATGTATAAGTAGAAGTAA
TTTGAGGTGTGCCAACGACACACTTGGAAGGTAGAAGGAATGATTTAATGAACAAAACAGTCTTGAACTATACTCCATTTAGAAAAGTATGACTGAAACC
AATGCACAGATTTAATAGGATTCCACATATACATAACAGTAATTTGCCACTTGCAAAAGAAGAAGCTACCAAAATA
page-top