Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2850  (registered. 2012)
Contig Information
Length 998 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242067401|ref|XP_002448977.1|| hypothetical protein SORBIDRAFT_05g002780 [Sorghum bicolor]
Score 273
Evalue 2.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2850
TTTTTTTTTTGTTGCAAACTGCCAGTCGGCAGGAATTTAGCATTCTCGTNNNNNNNTATAATTTTGGACAGACAGATATAATATGCACAGTAAAAAGAAA
TGGAGGGAGTACATTGGAAGTTACATTGAGTTCGTCATAAGCTAGATCACAATATCCTCCATCGCTTCCAAACTACGGCCACGGTCTCAATGCATCATTT
GAACCATGCAAATCAAAAGTCGGTTGAAAACCATTGTCTGGCACCACCACCAGTAAGCTGGCGGTAAGGTAAGGTTTAACTCGAAAAGGTACAGTACTTG
CTTGGCTGCGAAGTGACCCATCACTTGCATGCCTTCGTCTCTTTAGCCGAAGCATGGTAATTAATTTACATCTGTGTACATCCTAAGCAAAACCTAAAGA
AACAACTTTGGCTTCTCCCAGGAGCATGACCATGGGCTCATGGCCACACTCGATCGCATCGGCCAAGGAATATGGGGCTTCTGGTCCTCACGAGACAACG
TGTGACCCATTCTTCTTTGTTCTCAGGAAACTAACCAATGTGATCATGGGGGCAACACCCGTCCCCGAACGCTTCTTGATTGTTGTTGTCTTCCATGGCT
TTCCATCTTGCACAGTACCTGTGGTCGTAGACGTTACATTGTAAAACTCGCAAACACCATGTAATAGCAACCTCTGAAATGGGTCCTGGACATTCAACAC
AAGCACATCTTTATCAGTAGTGTCTTCAATGAAGGCCCTGATCCGTTCCTCATATATTTCAAGCAGTTCAGGTAGGAAGTTTCTCTTCATAGCTTCTCTT
GTTTGGCAATCTATACGGCGCCAAGCATTCAGCACAATTGACTCATCTTCATTCACAAGATTCTTCTGCTTAGCTGAGGATTGTTTCATCCGTTGCATAA
ATCTTGCCTCAACGTCCATGTCAATGCTCCTGAAGGCATCCCACTCACCAACACTTGTCCTGCAAAATGCTGACAGTGGTGCTTCCTCACCAAATGGC
page-top