Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28420  (registered. 2012)
Contig Information
Length 999 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_SH - 1
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_VABA Shoot with ABA treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115477899|ref|NP_001062545.1|| Os08g0567000 [Oryza sativa (japonica cultivar-group)]
Score 336
Evalue 2.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28420
GAGTACAATCTTCGCTGATATTAACAAAATACACTCCTCTCGATTGTTTTTTATTTATTTACGGGAAAATGAGAGAAGCCCATGCAGGCAATGGCAGTAC
AATTCTAGATGAACGGTTCACATAGCAACAGTATTTTTATGCTACACTGGGTGGTGGGTGAACAGCAAGCCCACACTCAGCGTCCCTACTGTAAACCCAA
GGTCCAAAGGAAAAAACCAAGCATGACTATTGAAAACTTCCATGCCATCGTGCGAAAATTCATATGTAAAACTAATCCATCTTGACATTTGAATATAGGA
GCGTGTCCCTGGTAAGCGGCATGTTCATGAGCAGGCAGATCCCAATGAGAGTTGAGACAAGGAGGATGATCCCTGTAATCCATGCAAGACTCAATCTAAC
AAGATATATAGCAGCTATAGAAGCTGTAGCATTAGTTTTCGATGCTTCTGCAAGCCGTCTTGAGATATGCAATGAAGATGGTCCATCGATGATGGATGCC
AAGGATGTTGAAGCCTCCTTAGTGGATATTACCAGCCCAACAATTTTCCCGTTATATGCTCCCTGCAATTGATCAAATGCTTTGGTGAGAGCTGTCTGAA
CTACTTCAGCTCCCTGCTTAACAATTTCTGCAGAACCATATTCATCTTCCAGAGCCTTAATGCCCGTGAAGCGGCATACTAATAACTCTGCAGGGCTCAC
GATGCCTCCTGAGAAATCTTCATGAACCTGAATACCCCTTTTGATGGTTTTGAGAAGGGAGATCAAGCTGGATGCAAATTCAACGTCTACTTCCTTATTG
AGGAGCAAAGTAAGACTGTTTCCACTCTTCAAGGGGATGTTTAATTTGCCATCAGCCTTCTGGTAGGATCCCTCCAACCAGGTTGCCAAGTCGGTGAGTT
CATTATCAAGAACATCTGATCCAGAAGATTCATGTGAACGAATGACAATCAATTCATCCTTATCTGTAAGCCCTGTAGCAGCATTTTGTGCACCCTCAA
page-top