Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28369  (registered. 2012)
Contig Information
Length 1538 bp
Clones alternative view 126 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 14
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 10
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 5
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XE Seedling, infected with leaf rust 28
WH_XF Seedling, infected with leaf rust 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 13
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115468544|ref|NP_001057871.1|| Os06g0561000 [Oryza sativa (japonica cultivar-group)]
Score 573
Evalue 2.00E-161
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28369
GTATCAGACCCTTCTTATTTTGGGCTAAAGTTTGATCATAAATTCAATGCACAAAATATAAACTATATGTCACAAAAATTAGACTGTATGAAACCTCTTT
TGTAGCACGTGCTTTATATTTTTAGAGATTCCCTCGTCAAGTTTTTGGGAAGGAATTTGCACACGTGTTTCAGCTTCCAAGGAGCAGATTCCGTTTACCA
GAGAAGAGTGCAAGCGGCACATACTTTCACACATACTGTATCTGTATGTACTTGCAAGGCGAGTAAAATCATTTCGTTTACAACCGTAGAAGTAGAACAG
AGCACACTCGAAAGACAACAAATACCGGCAAATAAATTTTATTAGGTATACGCATAATACGCATGGCTGATGGCCCTACTGGCAACGCTCGCTCAACTTG
GATGTGACATGGATCCGTATATATAGTAGTATCACGCACCATACACGTACGACAGCTTGGAACAATCTTTCATCCTTTTTGCTTTCGACGAAGGTAAATA
AACTATCATATGTTGTCTGGGTTCCGTTCCGTGTCTGGGTGCGGCCTCCTCACCATCGCACCTTCCCCGGGAAGTACTTGTCGATGAGCGACATGTAGTA
GGGCTTCACTTCCTCGACGTCGATCCTGACGCTGCTCTTGCTGTACAGGTCATACTTGTTGAAGACGTGCAGCCATTTGAGGTTCTCCTTGTCGTCCTCG
TTCATCAGGTGCATGTAGGCTCCATGCTTGTGCAGGGGGTAGAAGGAGTGGTATCTGATGATGAACAGCCCTGCAGAAGGAAGGGTGGTCTTGTTCTCCT
TGGCAACCAGGTACATGTAGTCGTCATGGCCCCATGACATGAGCACGTTGTCCAGCCCGCACCCCTCGGAGTAGGCCCCGAACTTGGTGTTGAACTCCGG
GTTGTGGTGGTCAGGGTTCTCCTTTAAGTACTTGAAGTGGACGTTGCATTCGTCGAACGCGCAGCCGACGGGGAAGGTGTCACCTACGACTGCCCACTGA
GGTAGCTCCCCGAAGCTGGGATGCAGCAGCACCTTGCCCAGATCATGGATGAGGCCAGTGAGGTGAAGCCAGTCCTCATCGGGGTAGTCCTTGCGGATGG
CCTCGGCGGTCTGGAGGAGGTGCTCAATCTGTGGCATGTCCAGGTCAGGGTCGCTGTCGTCTATGAACTCGTTGAGCAGCTCGATGCACTCCCAGATGCT
CATCTCCGTCTTGTCCAGCCGCCCATATGCATCCCGCATCCGCTGCACAAACTCGTACGTCTGGTTGATGTGGTTCACGCGGTAGAACTCCTCCACCGTC
TTCTTCCGCTCCGACTCCGCGTCGTAGTCCCTGAAGGTGTGGCCGAAGGCGTTGGAGTCCGGCACGGTGAAGCCGCCGTCGAGCACGAGCTCCCCCTGGT
CGCCGGCGACCTTCCTCTCCGCCGCCGCATCAAACTGAGGCTGCTCGATGATGATGGTCATCTTGAACGGAGAAAAGATTGCCGATCGGAGCTCGCAGCG
GCGAGGACGGCAGAGAAGCAGGGTCCAAGAAGACGGTA
page-top