Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig28339  (registered. 2012)
Contig Information
Length 1135 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218195137|gb|EEC77564.1|| hypothetical protein OsI_16498 [Oryza sativa Indica Group]
Score 506
Evalue 2.00E-141
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig28339
GGGCTCTCGCTCGCTGCTCCGGCGATTCACTGAGACTCTCCGTAGCCGGCGCGGCTTACCGTCACTTGGCGTCCCCCACGCTGGTCTCGGAGAGCACTGA
AATAAGCGTAATGGGCGAGGTAATGGCCGCACGGAGCAGAGGCGGCGCTAATGGGGAGGACGGCGAGCCGGTTGCACGTTGGCGAGCGGAGGAGGCTGTC
GCCGGGAACCGTATGGCCCTCCAGGCTCTCCGGGAGCTCGTGATTTATCCCTTCCTCTACGCTCGCCAGTCCCGCCTGCTCGGGCTTAAGTGGCCCAGAG
GATTGCTGCTCTACGGCCCCCCTGGGACAGGAAAGACAAGCCTGGTTCAAGCCATCGTTCGAGAATGCAGTGCCCACCTGACAATGATCAATACGTATTC
TGTGCATAAAGCTCATGCTGGAGAGGGTGAGAAGTTCCTGCGTGAAGCTTTCTCTGAAGCGTACTCTCAGGCGTCACAGGGCAGACCGGCCATTATTTTC
ATCGATGAACTGGATGCTATATGTCCACGCCGTAACAGTAGGAGAGAGCAAGAATCCCGCATTGTTGGTCAGCTGCTAACTCTGATGGATGGAAATAAGA
AATCGTCGAAGAAGCTTCCTCACGTAGTTGTTGTCGCGTCAACTAACAGGGTGGATGCCATCGATCCAGCATTGAGAAGGCCAGGACGTTTTGACTCAGA
GATAGAGGTCACTGTTCCTACGGTAGAAGAAAGGCTGCAGATTCTTAAGCTTTATTCCAAAAATCTGCATCTTGATGAAAATGTTGATCTTCAAATTATC
GCTGGATGGTGCAATGGTTATGTTGGTGCTGATCTAGAAGCTCTGTGTCGAGAAGCTGCCAGACTTGCTTATCGGAGATTGTCAAACTCATCCGAGAATG
GGAAGGTGCTCACACTACTCATGGAAGATTGGGAGTCTGCGAAATCTCAGATCAAAGCAAGCATGATAAGAGGGGTAACTAAAGAAGCTCCAACTGTTTC
ATGGGATGATATAGGAGGTTTGAAAGATCTAAAGAAAAAGCTTCAGCAAGCTGTTGAGTGGCCCATCAAGCATGCCACTGCCTTTGCAAGACTGGGGATA
TCACCAGTTCGTGGTGTGCTTTTGCATGGTCCTCC
page-top