Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2824  (registered. 2012)
Contig Information
Length 700 bp
Clones alternative view 75 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 3
WH_XA Root 8
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 10
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242049264|ref|XP_002462376.1|| hypothetical protein SORBIDRAFT_02g024610 [Sorghum bicolor]
Score 234
Evalue 8.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig2824
GCACGAGGCCACTCTTTGCCCAAGCCCCCCTACTGCCGGCGGCGGAGACGACGGAAACATGGTGCAGCGTCTGACGTACCGGAAGAGGCACAGCTATGCC
ACCAAGTCCAACCAGACGCGGGTCGTCAAGACCCCAGGTGGTAAGCTCGTGTACCAGTACACCAAGAAGAGGGCGAGCGGCCCCAAGTGCCCTGTGACCG
GGAAGAAGATCCAGGGGATTCCCCACCTCAGGCCTACTGAATACAAAAGATCAAGGTTGTCTAGGAACCGCAGGACTGTGAACCGTCCCTATGGTGGAGT
GCTCTCTGGAACTGCAGTGAGGGAAAGGATCATCCGCGCCTTCTTGGTGGAGGAGCAGAAGATCGTGAAGAAGGTGTTGAAAATACAGAAGACCAAGGAC
AAGACGACCTCAAAGTAATCTGATTGAAACGGAAGTGCGAAGTGAGATGGTGTTCTGTAAACAAGGAAAATATTTTTGTTGGTGGTTATGATCAATGGTT
TAGTCCCTTCTAGCTAAATGTTTTAGAGTACTTGAAATCCTTCTGCTGCCGTGACATCAGAGATTGTGAAACATTTGATACCCATTTGCAGTTTCATTTC
TGAATGCATGTTGAATCTACTTATGTTAATTTGGTTTCACATAGCATTTGTGGTTATCTATCTATAACAAAAAAAAAATTACTCCCGCTCAAAAAAAAAA
page-top